Assessing musclegene expression during in vitro differentiation of mES cells

5.1 RNA isolation from cell extracts

The expression of muscle-associated genes during EB culture and ongoing differentiation is most commonly analysed by RT-PCR using isolated RNA. As a general guide, we recommend that at specified times EBs should be washed with PBS and, following cell lysis in an appropriate buffer, total RNA extracted according to established methods. We routinely purify RNA by ultracentrifugation through a caesium chloride gradient and employ guanidinium isothiocyanate, a chaotro-pic agent that inactivates ribonucleases (25). However, RNeasy Mini Kits (from Qiagen) or other similar kits also yield good-quality RNA. For detailed methods for RNA preparation, the reader is referred to Wobus et al. (9) or Chirgwin et al. (25).

5.2 Reverse-transcription PCR, and quantitative reverse-transcription PCR (Figure 4)

To determine the presence of muscle-associated gene transcripts, semiquantitative reverse-transcription PCR (or RT-PCR) may be employed (Figure 4A). Typically, total RNA (0.5-1.0 mg) is reverse transcribed (with MuLV reverse transcriptase) using as primers either oligo d(T)16 or random hexamers; RT reactions are carried out at 42 °C for 0.5-1 h, and then heated at >95 °C for 5min to terminate the reaction (see Protocol 8). Complementary DNA sequences (cDNAs) to the reverse DNA transcripts are then amplified from (* 1 ml) aliquots of the RT-reactions with DNA polymerase (e.g. Taq, AmpliTaq®) during PCR using primers specific for the genes to be analysed (Table 1). Mouse RNA extracted from heart, soleus muscle, or aorta should be used as positive controls in RT-PCR; and a distilled water sample should always be included as a negative, no-template control (NTC). Resulting

PCR fragments are separated electrophoretically on 2% agarose gels, and analysed by computer-assisted densitometry in relation to HPRT, b-tubulin, or GAPD (household genes, or internal controls). To collect reliable data, we recommend that RT-PCR be performed two to three times on a set of three to four independent RNA preparations. Data may be evaluated using statistical analyses, as described in 'User Bulletin #2' for the ABI PRISM7700 Sequence Detection System (which is accessible at the Applied Biosystems website, http://home. appliedbiosystems.com/).

By using quantitative (q)RT-PCR methods incorporating real-time detection systems, it is possible to determine the number of amplification cycles (defined as the 'threshold cycle') necessary to detect a signal, which is indicative of the abundance of a given transcript in the original RNA preparation (Figure 4B). There are two forms of quantification of RNA - absolute and relative. Absolute quantification assesses the number of template copies (as moles, grams, or molecules) in the sample, by reference to a defined, standard signal. To this end, standards corresponding to the target transcript usually are synthesized from reference DNA sequence with RNA polymerase, quantified spectrophotometrically, and added to the RT reactions in precise amounts (see User Guide for 7900 Sequence detection system, PE Applied Biosystems website). Relative quantification is simpler, giving the proportion of target to reference sequence as well as signal ratios between samples. Two fluorescence-based formats are available for detecting the threshold cycle, employing: (i) fluorescent-labelled, sequence-specific hybridization probes (e.g. TaqMan®, Amplifluor®); or (ii) the DNA-binding dye, SYBR Green I, whose fluorescence increases over 100-fold on binding to the minor groove of double-stranded DNA. In general, and when multiple gene targets are to be measured from limited sample numbers, the SYBR Green 1 protocol is the method of choice; but, when a limited number of gene targets are to be quantified from numerous samples, a TaqMan®-like protocol may be considered preferable. We perform realtime quantitative PCR (or Q-PCR) reactions (Protocol 9) with an ABI PRISM 7900 Sequence Detection System and a SYBR Green 1 protocol, in a 384-well plate format, after determining the optimal amplification programme for each primer set. More technical details are provided in the 'SYBR Green® PCR Master Mix and RT-PCR protocol' on the PE Applied Biosystems website, as are details of the TaqMan®-based methods. (Other systems also may give reliable data.) In addition to determining the dissociation curve for each primer set, we recommend separating electrophoretically the products of Q-PCR amplifications on an agarose gel after each run. For the generation of novel primer sets we use Primer Express 2.0 software (PE Applied Biosystems), but a list of useful primers for analysing muscle-restricted gene expression by qRT-PCR is provided in Table 2. All procedures should be performed under conditions that minimize DNA contamination.

5.3 Non-radioactive in situ detection of transcripts in EBs

In situ hybridization (ISH) is a technique that permits detection of RNA (or DNA) sequences in tissues, cells, or chromosomal spreads, based on the formation

Table 1 Primers for RT-PCR amplification of muscle-specific gene transcripts

Cell type

Gene transcript

Primer sequences

(5' to 3', Fw/Rv)

Product size (bp)

Annealing temp. (°C)

References

Cardiac

Cardiac a-MHC

CTGCTGGAGAGGTTATTCCTCG

301

64

(9)

muscle

GGAAGAGTGAGCGGCGCATCAAGG

Cardiac p-MHC

TGCAAAGGCTCCAGGTCTGAGGGC GCCAACACCAACCTGTCCAAGTTC

205

64

(9)

Myosin light

TGT GGGTC ACCT GAGGCTGTG GTTCAG

189

60

(9)

chain-2V

GAAGGCTGACTATGTCCGGGAGATGC

(MLC-2V)

Myosin light

CAGACCTGA AGG.AGA CCT

286

5 2

(32)

chain-2A

GTCAGCGTAAAACAGTTGC

(MLC-2A)

Atrial natriuretic

TGATAGATGAAGGCAGGAAG CCGC

203

6 4

(9 )

factor (ANF)

AGGATTGGAGCCCAGAGTGGACTAGG

Nkx2. 5

CG ACG GAA GCCACGCGTGCT CCGCTGTCGCTTGCACTTG

181

6 0

(9 )

S keletal

Myf5

TGCTGTTCTTT CGGGACCAGACAGG

132

6 5

(9 )

muscle

GGAGATCCTCAGGAATGCCATCCGC

Myogenin

CAACCAGG AGGAGCGCGATCTCCG AGGCGCTGTGGGAGTTGCATTCACT

85

6 0

(9 )

MyoD

ATGCTGGACAGGCAGTCGAGGC GCTCTGATGGCATGATGGATTACAGCG

144

6 5

(9 )

Myf6

GAGGG TGCGG ATTTCCTGCGCACC GGAGGCTGAGGCATCCACGTTTGC

117

6 0

(9 )

M-cadherin

AACTGGAGC GTCAGCCAGATTAACG GCGCGGCAAACAGGATGAGAAC

386

5 6

(9 )

Smooth

Smooth muscle

GG ATGCCAC CACAGCCAAGT A

497

6 0

(9 )

muscle

myosin heavy chain (SM-MHC)

TGGTGTGGGTCCCTTCAGAGA

Muscle

Sarcoplasmic reticulum Ca2+ -ATPase

TGT GTGA TGTGGAGGA AATGTGTA TACAACTGAAGGCATGCATTACAA

224

6 5

Unpublished

Phospholamban

GC TAAGCTCCCATAAGACTT

695

58

(33)

(PLB)

CCAGACTGGAGCATATAAAGTG

Na+ / Ca2+

TCAAGGTAATCGATGACGAGGA

181

6 5

Unpublished

exchanger

TCTCTAGCATGGACCTTCCTGA

(NCX1)

L-type calcium

GG TAATCCACCCACGGA GAAGC

295

6 5

Unpublished

channel

GAGGCTCAAGGTCACAGCCA

Internal

p-tubulin

GG AACATAGCCG.TAAA CTGC

317

6 0

(9)

controls

TCACTGTGCCTGAACTTACC

HPRT M1/P1

CG CTCATCTTAGGCTTTGTATTTGGC AGTTCTTTGCTGACCTGCTGGATTAC

447

6 0

(9)

HPRT M2/P19

GC CTGTATCCAACACTTCG AGCGTCGTGATTAGCGATG

502

6 4

(9)

DRn

CtL 7+0 7 + 3 \

V /

/

î

0 10 20 30 40 Cycle Number

0 10 20 30 40 Cycle Number

Figure 4 Analysis of muscle-restricted gene expression in R1 mES cell line-derived EBs. (A) Semiquantitative RT-PCR amplification of muscle-related gene transcripts. RNA was prepared from undifferentiated mES cells, and from EBs at the indicated time points after plating at day 7. A no-template control (NTC) was included. Primers for the housekeeping gene, p-tubulin (p-Tub), were used as an internal standard for RT-PCR reactions. (MHC = myosin heavy chain; NCX1 = Na+ /Ca2+ exchanger.) (B) Differentiation-regulated transcript abundance as determined by quantitative (q) RT-PCR with SYBR Green 1. In this plot of signal against PCR cycle number, smooth muscle a-actin (SMA) amplifications are shown for RNA from EBs at days 7 + 0, and 7 + 3. A shift of the curve to the left with increasing time of culture indicates increased transcript abundance. DRn = (Rn+ )-(Rn~), where Rn is the ratio of SYBR Green 1 Emission intensity to the Passive Reference (ROX) for the sample (R+), or for the NTC/early cycles of amplification (R~). The horizontal line (see horizontal arrow) indicates the threshold points through the amplification curve. 'Ctl' indicates the amplification plot for a control sample of known concentration. Insert: the dissociation plot for SMA amplicons shows a single spike at *81.5 °C, which corresponds to the predicted melting temperature of this product.

of double-stranded hybrid molecules between those target sequences and complementary, single-stranded, labelled probes. For gene expression analysis in differentiating cell populations, ISH is particularly informative when combined with qRT-PCR based approaches, which cannot independently

Protocol 8

Reverse transcription

Reagents and equipment

• EB-derived RNA preparation (see

• TaqMan® Reverse Transcription Reagents

Section 5.1)

(Cat. No. 8080234, PE Applied Biosystems)

• DNA-free kit (Cat. No. 1906, Ambion)

• DNase-free microfuge tubes (Eppendorf)

Protocol 8 continued

• Benchtop microfuge • Spectrophotometer, e.g. GeneQuant pro

• Thermal cycler, e.g. Gene Amp PCR System (Pharmacia Bi°tech) 9700 (Applied Biosystems)

0 0

Post a comment