Primitive erythroid cell differentiation

After seeding mES cells onto OP9-cell monolayers in the presence of VEGF and BMP-4, mES cells start to differentiate and mesoderm-like colonies are observable around day 4, where the day of initiating coculture is designated as 'day 0'. Cells within these colonies are highly refractile and morphologically distinguishable from those in undifferentiated mES-cell colonies; and fibroblastic cells may be observed to emanate from and surround these differentiated colonies (Figure 2A). At this stage, the OP9 cells and mesodermal-differentiated colonies are harvested together by trypsinization, and the single-cell suspension so generated is reseeded onto fresh monolayers of OP9 cells. In order to induce primitive erythroid cell development from these mesodermal derivatives, the cells are cocultured in the presence of Epo, SCF, and IL-3. After a further 2 d of culture (i.e. on day 6 of differentiation), clumps of rounded, haematopoietic cells appear on the OP9 cells (Figure 2B, D), and are easily detached from the OP9-cell monolayer. These cells correspond to eryP, the first (primitive) erythrocytes to be formed during embryonic development. They show characteristic morphological features when examined by May-Grunwald/Giemsa staining, and also may be stained using anti-ey-globin antibody (17) or benzidine (18). Primitive erythroid cells are distinguishable from definitive erythroid cells by RT-PCR analysis of expression of genes for ey-globin (for primitive erythroid cells), and for b-major

Figure 2 Photomicrographs of differentiating mES cells during coculture with OP9 stromal cells. (A) On day 4 of coculture under mesoderm-inducing conditions, mES cells can be observed to have differentiated and to have formed colonies of mesodermal cells, with outgrowths of fibroblastic cells. (B-E) With continued coculture in the presence of haematopoietic factors, the mesodermal derivatives differentiate further into primitive erythroid cells by day 6 (B, D) and definitive erythroid cells by day 12 (C, E). Note that definitive erythroid cells (E) are relatively smaller than primitive erythroid cells (D), and adhere more tightly to the stromal layer. Micrographs (A-C) and (D-E) are at the same magnification, with the scale bars representing 50mm.

Figure 2 Photomicrographs of differentiating mES cells during coculture with OP9 stromal cells. (A) On day 4 of coculture under mesoderm-inducing conditions, mES cells can be observed to have differentiated and to have formed colonies of mesodermal cells, with outgrowths of fibroblastic cells. (B-E) With continued coculture in the presence of haematopoietic factors, the mesodermal derivatives differentiate further into primitive erythroid cells by day 6 (B, D) and definitive erythroid cells by day 12 (C, E). Note that definitive erythroid cells (E) are relatively smaller than primitive erythroid cells (D), and adhere more tightly to the stromal layer. Micrographs (A-C) and (D-E) are at the same magnification, with the scale bars representing 50mm.

ALAS-E

ALAS-E : GTCCTGTGGAGGAATTGTGT GTTTTCCATCATCTGAGGGC

sy-globin ey-globin : AACCCTCATCAATGGCCTGTGG TCAGTGGTACTTGTGGGACAGC

ß-major globin

ß-major globin : ATGGTGCACCTGACTGATGCTG GGTTTAGTGGTACTTGTGAGCC

HPRT

HPRT : GCTGGTGAAAAGGACCTCT CACAGGACTAGAACACCTGC

Figure 3 RT-PCR analysis of primitive and definitive erythroid cells. Mature haematopoietic cells were harvested from supernatant medium of mES/OP9-cell cocultures on days 8, 11, and 14. Total RNA was extracted from the cells, and cDNAs reverse transcribed according to (16). PCR was performed on cDNAs for 30 to 36 cycles, using the indicated primers and the following conditions: 94°C for 20s, ramp time for 1 min, 55°C for 1s, and 72°C for 1 min. Amplified products were separated electrophoretically on a 1% agarose gel and stained with ethidium bromide. Amplifications for ey-globin transcript revealed strong induction of expression (denoting the presence of primitive erythroid cells) at day 8; and for p-major globin and ALAS-E (denoting the presence of definitive erythroid cells) at day 11, which was sustained at day 14. Amplifications for HPRT transcript represent the internal control.

globin and erythroid-specific 5-aminolevulinate synthase (ALAS-E) (for definitive erythroid cells) (Figure 3).

0 0

Post a comment