Protocol 4 continued

5 Transfer individual coverslips (cell-side up!) onto microscope slides, and delineate the circumferences of the coverslips on the slides using a silicon pen.c

6 Wash the samples gently with PBS, apply primary antibodies at the appropriate dilution, and incubate slides in a humidified chamber for 1 h at r.t.

7 Wash the samples gently with PBS twice, apply Cy3-conjugated secondary antibody, and incubate in a humidified chamber for 30 min at r.t.

8 Wash the samples gently with PBS twice, and once with TO-PRO solution.

9 Apply a small quantity of mounting medium to the samples and cover with a rectangular coverslip.

10 Allow the mounting medium to air-dry, and then seal the edges of the rectangular coverslips onto the slides with nail polish.

11 Using confocal microscopy, locate and examine the depth of organization of vessellike structures by scanning different layers within the EBs.

aThis protocol was developed using the following hES cell lines: H9, H9.2, H13, I6, and I9. b Alternatively, for immunofluorescence analysis EBs may be plated directly onto, and processed in, a 4-well chamber slide system (Cat. No. 177399, Nunc). These slides are similarly precoated with gelatin.

c This will allow the application of a minimal volume of antibody solution.

representing endothelial and haematopoietic derivatives, respectively. The SMA+ population includes epithelial cells that are organized as sheets in different locations within the EBs, flattened cells with particularly intensive SMA expression, and more elongated cells forming wide tubes (Figure 4B). Together, these tubular channels and cords carry the hallmarks of a primitive vascular network.

4.3 Cardiac differentiation in EBs

When EBs are cultured in suspension to the stage when they become cystic (at day 8-14), a minority of them display rhythmic pulsing due to the spontaneous contractile activity of cardiac-muscle cells lining their central cavities (9, 45). These contractile areas within EBs display properties consistent with an early-stage cardiac phenotype, including expression of structural proteins such as actin, as well as proteins of gap junctions such as Cx40 and Cx43 (9, 10). The plating of contractile EBs onto an adhesive substratum to induce attachment and spreading facilitates observation of such areas, and enables their functional characterization. In particular, the culture of contractile EBs on microelectrode array systems (MEA; Protocol 5) proves both convenient and highly informative (see also Chapter 6, Section 6.3). These systems comprise 60 microelectrodes with diameters of 10-30 mm, and were developed originally to: (a) record spatiotemporal parameters of electrophysiological activity propagating through

Table 1 Human-specific primers for RT-PCR analysis of lineage-restricted gene expression (highlighting vascular genes), and PCR conditions

Cell type

Gene transcript

Product (bp)

Cycles

Conditions Annealing temp. (°C)

Neuron

Neuron

Keratynocyte

Cardiac muscle

Cartilage

Hepatocyte

Hepatocyte

Early endoderm/ Cardic muscle Kidney

Endothelial

Endothelial

Haemato-vascular

Vascular

Vascular

Neurofilament 68 kD

Dopamine ß

Hydroxylase (DßH) CK10

a-cardiac actin

Albumin a-fetoprotein

GATA 4

Renin

CD3 1

CD34

Tal-1

Angl

Ang2

to w

GAGTGAAATGGCACGATACCTA 473

TTTCCTCTCCTTCTTCACCTTC

CACGTACTGGTGCTACATTA AGGAGC 440

AATGGCCATCACTGGCGTGTACACC

GCTGACC TGGAGATGCAAATTGAGAGCC 1 29

GGGCAGCATTCATTTCCACATTCACATCAC

GG.AGTTATGGTG GGTATG GGTC 4 68

AGTGGTGACAAAGGAGTAGCCA

ATGACTGTGAG CAGGTGTGC 2 24

GTCCAGCGTATCCACGATCT

TGCT TGAATGTGC TGATGACAGGG 1 57

AAGGCAAGTCAGCAGCCATCTCAT

GC TGGATT GTCTGC AGG ATGGGGAA 2 16

TCCCCTGAAGAAAATTGGTTAAAAT

AG ACATCGCACTGACTGAGAAC 4 75

GACGGGTCACTATCTGTGCAAC

GTGTCTGTG GGGTC ATCC 1 42

ATCAAACAGCCTCTTCTTGGC

CAACGAGAAAATGTCAGA 260

GGAGCCTTCCGTTCTAGAGT

TGAAGCCTAGCCTGTCACCT 2 00

CGCACAGCTGGAGGTCTTAT

ATGGTGCAGCT GAGTCCTCC 3 31

TCTCATTCTTGCTGAGCTTC

GG GGGA GGTTGG ACTG TAAT 3 62

AGGGCACATTTGCACATACA

GG.ATCTGGGGAGAGAGGAAC 5 35 CTCTGCACCGAGTCATCGTA

1.5 1.5 1.5 2.0 1.5 1.5 1.5 1.0 1.5 1.5 1.5 1.5 1.5 1.5

4 Table 1 (Continued)

Cell type Gene transcript Primer sequences (5' to 3', Fw/Rv) Product Conditions

(bp) Cycles Annealing [MgCl2]

Endothelial Endothelial Endothelial Endothelial Vascular

Endothelial Endothelial Smooth muscle Smooth muscle Smooth muscle Smooth muscle Household gene

Tie2 ATCCCATTTGCAAAGCTTCTGGCTGGC 512 35

TGTGAAGCGTCTCACAGGTCCAGGATG VE-c ad ACGGGATGACCAAGTACA GC 596 35

ACACACTTTGGGCTGGTAGG KDR CTGGCATGGTCTTCTGTGAAGCA 790 35

AATACCAGTGGATGTGATGGCGG Vo n W illebrand ATGTTGT GGGAGATGTTTGC 656 40

factor (vWF) GCAGATAAGAGCTCAGCCTT

aVEGF outer GGGCAGAATCATCAC GA 534 483 35

CCGCCTCGGCTTGTCACA aVEGF inner ATCGAGACCCTGGTGGACA 411 351 279

CCGCCTCGGCTTGTCACA AC133 CAGTCTGACCAGCGTGA AAA 200 32

GGCCATCCAAATCTGTCCTA VCAM GAA GCCAGCTTCCACATAAC 700 35

AGTGGTGGCCTCGTGAATGG SMA CCAGCTATGTGAAGAAGAAGAG G 96 5 35

GTGATCTCCTTCTGCATTCGGT Calponi n GAGTGTGCAGACGGAACTTCAGCC 671 35

GTCTGTGCCCAACTTGGGGTC Caldesmon AAC AAC CTGA AAG CCAGGAGG 53 0 35

GCTGCTTGTTACGTTTCTGC SM-MHC AAGCCAAGAGCTTGGAAGC 179 35

TCCTCCTCAGAACCATCTGC GAPDH AGCCACATCGCTCAGACACC 302 27

GTACTCAGCGCCAGCATCG

60 60 60 55 55

60 60 60 60 60 62 60

a In order to detect the expression of different isoforms of VEGF, nested PCR should be performed, i.e. initial PCR amplification using 'outer-set' primers followed by additional PCR amplification of the product using 'inner-set' primers.

Figure 4 (see Plate 12) Vascular development within EBs. Immunofluorescence staining and confocal analysis of day 10-13 EBs for CD34 and SM-MHC reveal: (A) distinct areas with complex vascular structure composed of endothelial (CD34+ ) cells; and (B) smooth-muscle (SM-MHC + ) cells forming wide tubes, rarely with network formation. Scale bars = 50mm.

Figure 4 (see Plate 12) Vascular development within EBs. Immunofluorescence staining and confocal analysis of day 10-13 EBs for CD34 and SM-MHC reveal: (A) distinct areas with complex vascular structure composed of endothelial (CD34+ ) cells; and (B) smooth-muscle (SM-MHC + ) cells forming wide tubes, rarely with network formation. Scale bars = 50mm.

Table 2 Human-specific monoclonal antibodies for Immunostalnlng of vascular and cardiac-muscle cells derived from differentiated EBs

Mouse anti-human antibodies

Supplier

Dilution

Endothelial and smooth muscle markers:

CD34

CD31

Smooth-muscle myosin heavy chain (SM-MHC) Smooth-muscle alpha actin (SMA) Calponin

Cardiac markers: Sarcomeric a-actinin Troponin I

Myosin ventricular heavy chain alpha/beta Atrial natriuretic peptide (ANP) Isotype control: IgG1

Dako Dako Dako Dako Dako Dako

Sigma

Chemicon

Chemicon

Chemicon

R&D

M7165 M0823 M0616 M3558 M0851 M3556

A5044

MAB3438

MAB1552

CBL66

MAB002

1:20

1:20

1:50

1:20

1:100

1:50

1:500

1:5000

1:10

1:100

1:20

nervous or heart-muscle tissue, and (b) stimulate tissues electrically. Contractile hES cell-derivatives may be dissected from EBs and cultured on MEAs for days whilst their activity is recorded non-invasively. High-resolution activation maps are thereby generated that may demonstrate the presence of a functional syncytium with stable, focal activation and conduction properties (10). In addition, after plating intact, contractile EBs onto MEAs, the effects of cardiotropic drugs or other treatments may be evaluated (9, 10).

0 0

Post a comment