Experimental Approach

Effect of UV-B Radiation on P. lividus Embryo Development

Sea urchin embryos occurring in the superficial layers of seawater and lacking a protective epidermal layer are particularly prone to UV-B damage. The effects of UV radiation have been studied on larvae and early juveniles of the sea urchin Strongylocentrotus intermedius (Yabe et al. 1998). We used embryos of the sea urchin P. lividus as a cellular biosensor for monitoring the effects of UV-B and its combined effects with pollutants (cadmium).

The results showed that blastula and pluteus larvae are seriously damaged by UV-B when exposed to 500 and 1,000 J/m2.When embryos were exposed at the mesenchyme blastula stage to different UV-B doses and observed at 68 h of development, we found an increase in the number of defective embryos, which paralleled the increase in the UV dose used. Table 1 summarizes the results obtained, taking into consideration the two major perturbed categories, i.e. gut- and skeleton-defective embryos. The typical morphologies of aberrant embryos are shown in Fig. 5, which illustrates a representative experiment; while control embryos were well-developed plutei (Fig. 5a, b), UV-exposed embryos were partially inhibited in the differentiation of their endo-derm derivatives, as the three parts of the digestive apparatus failed to be properly organized (Fig. 5 c, g and d, h). Similarly, a severe inhibition of skele-

Table 1. Abnormalities in sea urchin embryos exposed to UV-B radiation. Numbers refer to the percentage of 100 embryos scored, having the following morphologies: Nnormal; G gut defects; S skeleton defects

Morphology UV-B radiation (J/m2)

Table 1. Abnormalities in sea urchin embryos exposed to UV-B radiation. Numbers refer to the percentage of 100 embryos scored, having the following morphologies: Nnormal; G gut defects; S skeleton defects

Morphology UV-B radiation (J/m2)

0

50

300

500

1000

N

92.9

77.6

48.0

19.4

4.8

G

7.1

22.4

33.3

66.7

72.6

S

-

-

18.7

13.9

22.6

Fig. 5a-j. Morphological observation of sea urchin embryos exposed to UV-B radiation at mesenchyme blastula stage. Embryos were continuously cultured for 66 h (48 h after irradiation). Control embryos (a, b), embryos with gut defects (c, d, g, h), and embryos with skeleton defects (e, f, i, j). Bar 50 mm

Fig. 5a-j. Morphological observation of sea urchin embryos exposed to UV-B radiation at mesenchyme blastula stage. Embryos were continuously cultured for 66 h (48 h after irradiation). Control embryos (a, b), embryos with gut defects (c, d, g, h), and embryos with skeleton defects (e, f, i, j). Bar 50 mm tal patterning was observed in UV-B-exposed embryos, which showed either a failure in proper elongation or incorrect patterning of skeletal rods (Fig. 5e, i and f, j). As a consequence, UV-B-treated embryos had poorly or asymmetrically developed arms.

It has already been mentioned that UV radiation, causing DNA damage, induces the expression of genes involved in the DNA repair machinery. The human XPB/ERCC-3 DNA excision repair gene, coding for a helicase that unwinds the DNA in 3' to 5' direction, is highly conserved and related genes were found in different organisms: Drosophila melanogaster (Mounkes et al. 1992), Dictyostelium discoideum (Lee et al. 1997), Saccharomyces cerevisiae (Park et al. 1992), and Geodia cydonium (Batel et al. 1998).

Since it was known that XPB/ERCC-3 gene expression increases after UV treatment in sponges (Batel et al. 1998), it was conceivable to hypothesize its activation after UV stress also in other marine invertebrate organisms, like the sea urchin. Therefore, it was interesting to isolate the homologous cDNA in P. lividus embryos. To this end, we used as source total RNA from 32-cell stage embryos irradiated with UV-B, at a dose of 200 J/m2, and kept in the dark for 2 h. The degenerated oligonucleotide primers were designed on the

1 - GOT1. ;AGTGTGCCGAGGTATGGTGCCCAATGGCTCCAGAGTTCITCAGAGAGTATCTGGC - 60 V Q C 1EVVCP IJtPEFFBETLA 61 - AATTAGGAC TAGAA AGAGATTATTGCTGTATGTAATGAATCCC AATAAGTTCCGGGC ATG - 120 IRTRKRLLLYVMNPNKFRAC 121 - TC AGTT7C TTGTGTGGTIC C AC G AGO AGO GO A AC GAC AAGGTC ATC GTCTTCTC AG ATA A - ISO

QFLVWFHEQRNDKVIVFSDN 131 - CGTCTTTGCTCTAAAGCATTiTGCAATAGCTATGGGCAGACCGTATATCTATGGGCCTAC - 240

VFALKHYAIAMGRPY IYGPT 241 - AAGTCAAGGAGAGAGGATGCAG ATC TTAC AGA AC TTTC AAC AC AAC C C TGC CGTC A ATAC - 300

SQGERKQILQNFQtiMPAVNT 301 - AATCTTCATTTCCAAGGTCGGTGATMTTCCTTTGATCTTCCCGAGGCTAATOTTCTCAT - 360

IFISKVGDNSFD LPEANVLI 3 61 - C C AGGTTTCATCCC ATGGTGGATC A AGAAGACAAGAAGCTC A ACGTC TAGGTCGTATCCT - 420

QVSSHGGSRRQE AQRLGRIL 421 - C AGAGC TAAGA AAGGTGC TGCAGCGGAGGAG TATAAC G CC T TC TT C TA C- 4 69 R A K K G

AAAEEYNAFFY

Fig. 6. Nucleotide sequence of Paracentrotus lividus cDNA encoding the DNA repair heli-case XPB/ERCC3 (Pl-ercc3), and its deduced amino acid sequence. Forward and reverse oligonucleotide primers used for RT-PCR amplification are underlined basis of a multiple sequence alignment of the three XPB/ERCC-3 nucleotide sequences from Drosophila (Mounkes et al. 1992), mouse (Weeda et al. 1991), and G. cydonium (Batel et al. 1998). The partial cDNA sequence (469 bp) and its deduced amino acid sequence [deposited in the National Center for Biotechnology Information (NCBI) databank; accession number AJ439717] are shown in Fig. 6. The comparative analysis revealed an 87 % amino acid identity with Ciona intestinalis (NCBI accession no. T31655), 83% with Mus musculus and Homo sapiens (Weeda et al. 1990), 80% with D. melanogaster, 73% with G. cydonium and Caenorhabditis elegans (Hartman et al. 1989), 69% with S. cerevisiae (Park et al. 1992), and 67% with D. discoideum (Lee et al. 1997). The Pl-ercc3 probe is currently used in Northern blotting and RT-PCR experiments with embryos exposed to UV-B radiation (unpubl. results).

Effect of Cadmium on P. lividus Embryo Development

A study of the effects of sublethal concentrations of cadmium chloride on sea urchin embryo development revealed a decrease in the percentage of normal embryos with increasing concentrations of cadmium chloride (10-6 to 10-3 M) 24 and 48 h after fertilization (Russo et al. 2003). Embryos exposed to 10-5 to 10-3 M cadmium chloride developed no significant differences compared to controls until the swimming blastula stage (about 12 h after fertilization). However, these embryos showed developmental defects when control embryos reached the late gastrula stage (about 24 h of culture). The number of delayed and abnormal embryos increased with increasing concentrations of cadmium chloride. At 10-3M cadmium chloride, 51-67% of the embryos were delayed at the early gastrula stage. Concentrations of cadmium chloride higher than 10-3 M were lethal to the embryos. These results confirm previous studies (Pagano et al. 1982; Fernandez and Beiras 2001; Radenac et al. 2001) and are in agreement with the results from studies on vertebrates (Chernoff 1973; Layton and Layton 1979; Samarawickrama and Webb 1979). Our recent studies on time-dependent continuous exposure of P. lividus sea urchin embryos reveal the synthesis of a specific set of stress proteins (90,72-70,56, 28 and 25 kDa) which was dependent on the duration of the treatment (Roc-cheri et al. 2004).

Metallothioneins are possibly involved in detoxification processes in marine organisms occurring after exposure to heavy metals such as cadmium, zinc and copper (Bonham et al. 1987; Lyons-Alcantara et al. 1998; Cajaraville et al. 2000). Therefore, we also investigated the effects of exposure to sublethal concentrations of cadmium chloride on the expression of the metallothionein gene during the development of P. lividus sea urchin embryos (Russo et al. 2003). Northern blot analysis and RT-PCR experiments revealed that the metallothionein gene is constitutively expressed at low levels in control embryos at cleavage, swimming blastula, late gastrula and pluteus stages (6,12,24 and 48 h after fertilization; Russo et al. 2003). The levels of metalloth-ionein transcripts increase with the developmental stage, in agreement with results reported by others (Wilkinson and Nemer 1987). However, when embryos were cultured in the presence of sublethal concentrations of cadmium chloride and harvested at cleavage, swimming blastula, late gastrula and pluteus stages, a time- and dose-dependent increase in the levels of transcription of metallothionein gene was observed (Russo et al. 2003). Embryos exposed to 10-5 M cadmium chloride showed, if at all, only a very small increase in metallothionein mRNA, in agreement with the absence of morphological abnormalities; at 10-4M cadmium chloride a modest increase in metallothionein expression was observed, while embryos exposed to 10-3 M cadmium chloride showed a strong increase in the levels of metallothionein transcripts at the blastula (12 h; three-fold) and gastrula (24 h; two-fold) stages. Quantitative analysis of sea urchin embryos using a relative RT-PCR showed a two-fold increase in the levels of metallothionein transcripts even after 6 h following cadmium exposure, and a three-fold (two-fold) increase after 12 h (24 h), confirming results obtained by Northern blotting. The levels of metallothionein transcripts decreased in embryos treated for 48 h. Interestingly, morphological abnormalities were observed only after 24 h of exposure to the pollutant. An increase in expression of metallothionein gene after cadmium exposure was also found in the marine sponge Suberites domuncula (Schröder et al. 2000b).

Besides development of malformations, DNA damage and disturbances of mitotic spindle formation have been described in sea urchin gametes and embryos following cadmium exposure (Pagano et al. 1982).

0 0

Post a comment