Info

Cycle Threshold (CT)

Fig. 4. (continued) initial template. (B) Relative increases in expression for several genes in P-19 cells are shown. The comparative CT method is applied to determine differences in gene expression between a specific time point and the 0-time point (retinoic acid treatment). Expression patterns for samples taken during the 4-d induction period and the 7-d differentiation period are shown, and the two periods are separated by a line. Error bars denote standard deviation.

Fig. 4. (continued) initial template. (B) Relative increases in expression for several genes in P-19 cells are shown. The comparative CT method is applied to determine differences in gene expression between a specific time point and the 0-time point (retinoic acid treatment). Expression patterns for samples taken during the 4-d induction period and the 7-d differentiation period are shown, and the two periods are separated by a line. Error bars denote standard deviation.

Fig. 5. Comparison of quantitative real-time polymerase chain reaction methods. The relative fold increase between undifferentiated (0 time-point) and differentiated (seventh day of differentiation) P-19 cells for various genes is calculated using qRT-PCR data generated from the use of single LUX primers, multiplex LUX primers, or the 5' nuclease assay. Error bars show standard deviation.

Fig. 5. Comparison of quantitative real-time polymerase chain reaction methods. The relative fold increase between undifferentiated (0 time-point) and differentiated (seventh day of differentiation) P-19 cells for various genes is calculated using qRT-PCR data generated from the use of single LUX primers, multiplex LUX primers, or the 5' nuclease assay. Error bars show standard deviation.

of the PCR. The use of blunt-ended hairpin PCR-primers has been shown to reduce primer-dimers and mispriming (24,25). The detection of potential mispriming products and primer dimers that may amplify during PCR are a potential problem of the fluorogenic primer method, as in other classic end-point PCR methods. In order to reduce the appearance of these artifacts, a "hot-start" DNA polymerase (26) and primer design software like the LUX Designer as described here should be used.

2. As an example, real-time qRT-PCR using LUX primers with in vitro transcribed ChAT mRNA is tested over a broad dynamic range of 66 to 107 transcripts. The standard curve should show the expected results with an R2 in the range of 0.990 and a slope in the range of -3.35. The plot may be used as a calibration curve for absolute copy numbers. The CTs obtained from unknown samples can be compared to the standard curve to estimate the copy number of the unknown samples. The data for ChAT (Fig. 3B) indicate that a CT of 31 obtained in the induced samples represents a copy number of approx 65. The possible issue of different efficiencies for a qRT-PCR of a single, pure mRNA species vs a mixture of cellular RNA is not addressed here. The use of TOPO-charged elements to generate mRNA is a rapid and easy method that may be used to generate a standard curve based on RNA.

Table 3

Primers and Probes for 5' Nuclease Assays

Table 3

Primers and Probes for 5' Nuclease Assays

Gene

Position

Sequence

GAPDH

F-5'-251

gggaagcccatcaccatctt

R-3'-326

cgacatactcagcaccggc

P-5'-276

ttcctacccccaatgtgtccgtcgt

ChAT

F-5'-598

ggcagcacttccaagacacc

R-3'-673

gccttgtagctaagcacaccaga

P-5'-620

catcgtggcctgctgcaacca

GAP-43

F-5'-712

ggctgaccaagaacatgcct

R-3'-787

ggcaggagagacagggttca

P-5'-744

ttccacgttgcccccacctga

GLUR1

F-5'-2405

agcgcctcctagttggcct

R-3'-2480

atgcgtgcaatacgattggtt

P-5'-2426

caggtggaagacaggcgccca

NMDA1

F-5'-2555

ctggaggcatcgtagctgg

R-3'-2630

ttcctacgggcatccttgtg

P-5'-2582

tgttcttccgctccggctttgg

Sequences are written 5'—3'. All PCR products are around 75 bp. F, forward primer; R, reverse primer; P, probe.

Sequences are written 5'—3'. All PCR products are around 75 bp. F, forward primer; R, reverse primer; P, probe.

3. Real-time PCR with LUX primers can be used for simultaneous rapid gene expression profiling of multiple genes that are possibly involved in P-19 cell differentiation (18). Data are analyzed with the comparative AACT method for calculating the change in the relative expression between samples. Different patterns of expression can then be observed for the transcripts studied. The neuronal genes NMDA, GLUR1, GABA-Bla, and GAP-43 typically increase 100- to 1000fold during the 7-d differentiation period. The increases in NMDA1 and GluR1 are in accordance with other experiments that investigated changes in the levels of expression of these genes in P-19 cells (27,28). The increase of expression of GABA-A receptors is described in differentiated P-19 cells (29), and GABA-B receptors were studied (30) and found to be expressed in neurons (31). The increase of GABA-B1a expression in differentiated P-19 was first reported in a study with LUX primers (18). The GAP-43 protein reaches high levels in differentiated P-19 cells after 8 d in culture (32). We show a complementary increase in GAP-43 transcript that precedes the high level of protein expression reported. The increase in the neuronal gene, ChAT, is approx 10-fold. This relatively low expression may result from a low number of cholinergic neurons formed during the differentiation process (18). As reported, cell density has no affect on the number of glutamatergic and GABAergic cells (33). The low expression of ChAT

found here, may result from the density of P-19 cells in culture. BMP2-inducible kinase and BMP4 are induced approx 10-fold and induction occurs mostly during the 4-d induction period. BMP2 inducible kinase is a novel kinase involved in the regulation of differentiation programs (34) and BMP4 is produced in undifferentiated cells and may act with retinoic acid to induce astroglia differentiation in P-19 cells (35). BDNF, a neurotrophic factor, also increases approx 10-fold during the induction period. BDNF receptors are expressed in neural precursors and BDNF plays a role in neurogenesis (36,37). Additional work to identify the expression pattern of different cell types in these cultures would be useful for future studies of P-19 differentiation. The rapid increase in EGR1 expression is consistent with studies that demonstrate that EGR1 is expressed early during differentiation of P-19 cells, and that EGR1 plays a role in differentiation (38). Nestin, also implicated in P-19 differentiation, increases during the 4-d induction period. It has been shown that expression of nestin increases and then declines with a similar time course (39).

Acknowledgment

We thank Irina Nazarenko for the initial development of the LUX system, David Saile for software development, Rick Pires for oligonucleotide synthesis, and Brian Lowe and colleagues for their work on the P-19 cell model.

References

1. Bustin, S. A. (2000) Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169-193.

2 Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. (1996) Real time quantitative PCR. Genome Res. 6, 986-994.

3 Freeman, W. M., Walker, S. J., and Vrana, K. E. (1999) Quantitative RT-PCR: pitfalls and potential. Biotechniques. 26, 112-125.

4 Nazarenko, I. A., Bhatnagar, S. K., and Hohman, R. J. (1997) A closed tube format for amplification and detection of DNA based on energy transfer. Nucleic Acids Res. 25, 2516-2521.

5 Tyagi, S. and Kramer, F. R. (1996) Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14, 303-308.

6 Lee, L. G., Connell, C. R., and Bloch, W. (1993) Allelic discrimination by nicktranslation PCR with fluorogenic probes. Nucleic Acids Res. 21, 3761-3766.

7 Holland, P. M., Abramson, R. D., Watson, R., and Gelfand, D. H. (1991) Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonu-clease activity of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. USA 88, 7276-7280.

8 Wittwer, C. T., Herrmann, M. G., Moss, A. A., and Rasmussen, R. P. (1997) Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 22, 130-138.

9 Higuchi, R., Fockler, C., Dollinger, G., and Watson, R. (1993) Kinetic PCR analy sis: real-time monitoring of DNA amplification reactions. Biotechnology (W Y). 11,1026-1030.

10 Thelwell, N., Millington, S., Solinas, A., Booth, J., and Brown, T. (2000) Mode of action and application of Scorpion primers to mutation detection. Wucleic Acids Res. 28, 3752-3761.

11 Wiederholt, K., Rajur, S. B., and McLaughlin, L. W. (1997) Oligonucleotides tethering Hoechst 33258 derivatives: effects of the conjugation site on duplex stabilization and fluorescence properties. Bioconjugate Chem. 8, 119-126.

12 Clegg, R. M. (1992) Fluorescence resonance energy transfer and nucleic acids. Methods Enzymol. 211, 353-388.

13 Didenko, V. V. (2001) DNA probes using fluorescence resonance energy transfer (FRET): designs and applications. Biotechniques 31, 1106-1121.

14 Lyamichev, V., Brow M. A., Varvel, V. E., and Dahlberg, J. E. (1999) Comparison of the 5' nuclease activities of Taq DNA polymerase and its isolated nuclease domain. Proc. Natl. Acad. Sci. USA. 96, 6143-6148.

15 Myakishev, M. V., Khripin, Y., Hu, S., and Hamer, D. H. (2001) High-throughput SNP genotyping by allele-specific PCR with universal energy-transfer-labeled primers. Genome Res. 11, 163-169.

16 Nazarenko, I., Pires, R., Lowe, B., Obaidy, M., and Rashtchian, A. (2002) Effect of primary and secondary structure of oligodeoxyribonucleotides on the fluorescent properties of conjugated dyes. Nucleic Acids Res. 30, 2089-2095.

17 Nazarenko, I., Lowe, B., Darflerm M., Ikonomi, P., Schuster, D., and Rashtchian, A. (2002) Multiplex quantitative PCR using self-quenched primers labeled with a single fluorophore. Nucleic Acids Res. 30, e37.

18 Lowe, B., Avila, H. A., Bloom, F. R., Gleeson, M., and Kusser, W. (2003) Quantitation of gene expression in neural precursors by RT-PCR using self-quenched, fluorogenic LUX primers. Anal. Biochem. 315, 95-105.

19 McBurney, M. W., Jones-Villeneuve, E. M., Edwards, M. K., and Anderson, P. J. (1982) Control of muscle and neuronal differentiation in a cultured embryonal carcinoma cell line. Nature 299, 165-167.

20 Pfaffl, M. W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45.

21 Pfaffl, M. W., Horgan, G. W., and Dempfle, L. (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36.

22 Meng, Q., Wong, C., Rangachari, A., et al. (2001) Automated multiplex assay system for simultaneous detection of hepatitis B virus DNA, hepatitis C virus RNA, and human immunodeficiency virus type 1 RNA. J. Clin. Microbiol. 39, 2937-2945.

23 Vet, J. A., Majithia, A. R., Marras, S. A., et al. (1999) Multiplex detection of four pathogenic retroviruses using molecular beacons. Proc. Natl. Acad. Sci. USA 96, 6394-6399.

24 Ailenberg, M. and Silverman, M. (2000) Controlled hot start and improved speci ficity in carrying out PCR utilizing touch-up and loop incorporated primers (TULIPS) Biotechniques 29, 1018-1024.

25 Kaboev, O. K., Luchkina, L. A., Tret'iakov, A. N., and Bahrmand, A. R. (2000) PCR hot start using primers with the structure of molecular beacons (hairpin-like structure). Nucleic Acids Res. 28, e9.

26 Sharkey, D. J., Scalice, E. R., Christy, K. G., Jr., Atwood, S. M., and Daiss, J. L. (1994) Antibodies as thermolabile switches: high temperature triggering for the polymerase chain reaction. Biotechnology 12, 506-509.

27 Grant, E. R., Errico, M. A., Emanuel, S. L., et al. (2001) Protection against glutamate toxicity through inhibition of the p44/42 mitogen-activated protein kinase pathway in neuronally differentiated P19 cells. Biochem. Pharmacol. 62, 283-296.

28 Heck, S., Enz, R., Richter-Landsberg, C., and Blohm, D. H. (1997) Expression of eight metabotropic glutamate receptor subtypes during neuronal differentiation of P19 embryocarcinoma cells: a study by RT-PCR and in situ hybridization. Brain Res. Dev. Brain Res. 101, 85-91.

29 Chistina Grobin A., Inglefield, J. R., Schwartz-Bloom, R. D., Devaud, L. L., and Morrow, A. L. (1999) Fluorescence imaging of GABAA receptor-mediated intracellular [Cl-] in P19-N cells reveals unique pharmacological properties. Brain Res. 827, 1-11.

30 Sullivan, R., Chateauneuf, A., Coulombe, N., et al. (2000) Coexpression of full-length gamma-aminobutyric acid(B) (GABA(B)) receptors with truncated receptors and metabotropic glutamate receptor 4 supports the GABA(B) heterodimer as the functional receptor. J. Pharmacol. Exp Ther. 293, 460-467.

31 Towers, S., Princivalle, A., Billinton, A., et al. (2000) GABAB receptor protein and mRNA distribution in rat spinal cord and dorsal root ganglia. Eur JNeurosci. 12, 3201-3210.

32 Mani, S., Schaefer, J., and Meiri, K. F. (2000) Targeted disruption of GAP-43 in P19 embryonal carcinoma cells inhibits neuronal differentiation as well as acquisition of the morphological phenotype. Brain Res. 853, 384-395.

33 Parnas, D. and Linial, M. (1997) Acceleration of neuronal maturation of P19 cells by increasing culture density. Brain Res. Dev. 101, 115-124.

34 Kearns, A. E., Donohue, M. M., Sanyal, B., and Demay, M. B. (2001) Cloning and characterization of a novel protein kinase that impairs osteoblast differentiation in vitro. J. Biol. Chem. 276, 42,213-42,218.

35 Bani-Yaghoub, M., Felker, J. M., Sans, C., and Naus, C. C. (2000) The effects of bone morphogenetic protein 2 and 4 (BMP2 and BMP4) on gap junctions during neurodevelopment. Exp. Neurol. 162, 13-26.

36 Sheen, V. L., Arnold, M. W., Wang, Y., and Macklis, J. D. (1999) Neural precursor differentiation following transplantation into neocortex is dependent on intrinsic developmental state and receptor competence. Exp. Neurol. 158, 47-62.

37 Barbacid, M. (1995) Neurotrophic factors and their receptors. Curr. Opin. Cell. Biol. 7, 148-155.

38 Lanoix, J., Mullick, A., He, Y., Bravo, R., and Skup D. (1998) Wild-type egr1/

Krox24 promotes and dominant-negative mutants inhibit, pluripotent differentiation of p19 embryonal carcinoma cells. Oncogene 19, 2495-2504. 39 Lin, P., Kusano, K., Zhang, Q., Felder, C. C., Geiger, P. M., and Mahan, L. C. (1996) GABAA receptors modulate early spontaneous excitatory activity in differentiating P19 neurons. J Neurochem. 66, 233-242.

TaqMan® Reverse Transcriptase-Polymerase Chain Reaction Coupled With Capillary Electrophoresis for Quantification and Identification of bcr-abl Transcript Type

Rajyalakshmi Luthra and L. Jeffrey Medeiros

Summary

Real-time TaqMan® polymerase chain reaction (PCR) assays allow quantification of the initial amount of target in a specimen, specifically, and reproducibly. The major limitation of TaqMan PCR assays is that they do not detect the size of the amplified target sequence. TaqMan PCR coupled with capillary electrophoresis is an alternative approach that can be used to circumvent this limitation. In this chatper, the utility of this approach in the identification and quantification of bcr-abl fusion transcripts produced as a result of t(9;22)(q34;q11) in chronic myelogenous leukemia is described. In this assay, abl primer labeled at its 5'-end with the fluorescent dye NED® (Applied Biosystems [ABI], Foster City, CA) is incorporated into the bcr-abl fusion product during the real-time PCR. The incorporated NED fluorescent dye is then used subsequently to identify the specific fusion transcript present in a given specimen by high-resolution capillary electrophoresis and GeneScan® (ABI) analysis. Knowledge of the type of fusion transcript present in a specimen is useful to rule out false-positive results and to compare clones before and after therapy.

Key Words: Real-time TaqMan PCR, chronic myelogenous leukemia; bcr-abl fusion transcripts; abl; GeneScan; capillary electrophoresis.

1. Introduction

Real-time TaqMan polymerase chain reaction (PCR) assays monitor the fluorescence emitted during the reaction as an indicator of amplicon production during each PCR cycle, as opposed to the end-point detection, and allow quantification of the initial amount of the template in a sample most specifically, sensitively, and reproducibly (1-6). TaqMan PCR assays are based on

From: Methods in Molecular Biology, vol. 335: Fluorescent Energy Transfer Nucleic Acid Probes: Designs and Protocols Edited by: V. V. Didenko © Humana Press Inc., Totowa, NJ

the 5'—>3' exonuclease activity of Taq polymerase, and on a nonextendable TaqMan probe that anneals to target sequence. The probe is a 20-30 base oligonucleotide that is labeled with a fluorescent reporter dye at its 5'-end and a quencher dye at its 3'-end. Thus, while the probe is intact, the close proximity of the reporter and quencher prevents emission of any fluorescence by reporter dye owing to fluorescence resonance energy transfer. During the extension phase of PCR, the 5'—3' exonuclease activity of Taq polymerase cleaves the reporter dye from the annealed probe, releasing the reporter dye from the 3' quenching dye (no fluorescence resonance energy transfer) and resulting in an increase of fluorescence proportional to the amount of amplified product. The reporter dye then emits fluorescence that increases in each cycle proportional to the rate of probe cleavage. Because the cleavage occurs only if the probe is hybridized to the target, the detected fluorescence is specific.

One of the limitations of the TaqMan PCR assays is that they do not detect the size of amplified target sequences. TaqMan PCR coupled with capillary electrophoresis is an alternative approach that is used to circumvent this limitation (7,8). In this approach, amplification products are labeled during realtime PCR with a fluorescent dye that does not interfere with Taqman probes/ assay. Following real-time PCR, the fluorescent dye labeled PCR products are then separated by high-resolution capillary electrophoresis and GeneScan analysis for accurate determination of amplicon size. The application of this technology for detection and quantification of bcr-abl fusion transcripts in patients with chronic myelogenous leukemia is described (8).

Chronic myelogenous leukemia is characterized by the presence of the reciprocal t(9;22)(q34;q11) in which c-abl located on chromosome 9, and the bcr locus located on chromosome 22, are disrupted and translocated creating a novel bcr-abl fusion gene residing on the derivative chromosome 22 (9-11). In most cases, the breakpoint in abl occurs within intron 1. Depending on the breakpoint in bcr, exon 2 of abl (a2) joins with exons 1 (el), exon 13 (also known as b2), exon 14 (also known as b3), or rarely exon 19 (e19) of bcr resulting in chimeric proteins of p190, p210, and p230, respectively (Fig. 1). In the TaqMan assay described here, the 5'-end of the abl primer is labeled with the fluorescent dye NED (Applied Biosystems, Foster City, CA) is included along with e1 and b2 bcr primers during the multiplex TaqMan reverse tran-scription-PCR assay and, thus, is incorporated into the bcr-abl fusion product. The NED fluorescent dye in abl primer, without interfering with fluorescent TaqMan probe signal, allows subsequent identification of the fusion transcript by semiautomated high-resolution capillary electrophoresis and GeneScan analysis. This approach, which has a sensitivity of detection equivalent to other

Fig. 1. Schematic showing bcr-abl fusion breakpoints.

real-time reverse transcription PCR assays, requires no further manipulation to confirm or identify the specific fusion transcript in patient specimens.

2. Materials

1. 10X red blood cell (RBC) lysis buffer: dissolve 41.3 g NH4Cl, 5.0 g KHCO3, and 0.19 g of EDTA in 500 mL of autoclaved dH2O. Stable for 1 wk at 4°C.

2. Prepare fresh 1X RBC lysis buffer from 10X stock solution before use. Stable for 24 h at 4°C.

3. Plasmid standards: make serial dilutions of stock plasmid (12) to obtain 105, 104, 103,102, and10> molecules per 5 |L of water.

4. Cell lines: the bcr-abl-positive cell lines KBM7, K562, and B15 that carry b2a2, b3a2, and e1a2 fusion genes, respectively, are used as positive controls. The HL60 cell line is used as a negative control.

5. Size standard for capillary electrophoresis: the CST-ROX 50-500 DNA ladder (Bio Ventures) is used as internal size standard.

6. Labeled primers and probes: aliquote stock primers (10 |M) and probes (5 |M) in to small volumes and store frozen at -20°C.

7. Universal Master Mix 2X: use Universal Master Mix (Applied Biosystems) without AmpErase uracil N-glycosylase (UNG) for TaqMan PCR.

3. Methods

The TaqMan reverse transcriptase (RT)-PCR coupled with capillary electrophoresis for quantification and identification of bcr-abl transcript type essentially involves the following steps:

1. Isolation of RNA from clinical specimens and cell lines.

2. Conversion of RNA to complementary DNA (cDNA).

3. Quantification of bcr-abl transcripts by TaqMan RT-PCR.

4. Identification of bcr-abl transcript type by capillary electrophoresis and GeneScan analysis. As RNA isolation and the synthesis of cDNA are standard molecular techniques, owing to space limitations, only steps 3 and 4 are described in detail.

RNAses can be introduced accidentally into RNA preparation at any point during the isolation procedure though improper techniques. The following guidelines should be observed throughout the entire procedure:

1. Always wear disposable gloves.

2. Change gloves before and after leaving the RNA station.

3. Wipe the bench area with 10% bleach and change diapers at the end of the day.

4. Use sterile disposable plasticware and automatic pipets reserved only for RNA work to prevent cross-contamination with RNAses from shared supplies.

5. Maintain quality control (QC) log of reagent preparations.

6. To avoid cross-contamination open microcentrifuge tubes carefully and slowly using a tube opener, opening the lids away from the opened tubes. Avoid touching the inside lip of the lid.

3.1. Specimens

Purple-top vaccutainer tubes containing ethylenediamine tetraacetic acid are preferred to green-top tubes containing heparin for collection of bone marrow aspirates and peripheral blood specimens because of the inhibitory effects of heparin on PCR amplification (see Notes 1 and 2).

3.2. Erythrocyte Lysis and Isolation of Total RNA Using Trizol

RBCs must be removed from bone marrow and peripheral blood samples because porphyrin compounds are known to inhibit RT-PCR.

1. Assign a unique sample number for each specimen. Label each sterile 15-mL centrifuge tube with the unique specimen number.

2. For bone marrow aspirates, transfer the entire sample into a 15-mL centrifuge tube. For peripheral blood samples, isolate the buffy coat layer by centrifugation and transfer the entire buffy coat layer into a 15-mL centrifuge.

3. Add 1X RBC lysis solution up to the 14-mL mark of the 15-mL tube containing the specimen.

4. Place tube on a rocker for 5 min. When the RBCs are lysed, the solution becomes translucent. If this does not occur after 5 min, allow the sample to continue lysing for an additional 5 min.

5. Centrifuge 15-mL tubes at 100g for 5 min.

6. Carefully decant off the lysed RBCs and turn the tube over onto a piece of sterile gauze to drain (be sure not to mix up the caps). Discard supernatant into the aqueous waste container (10% bleach).

7. Repeat steps 3-6 if white blood cell pellet is red.

3.2.2. RNA Isolation

RNA is isolated from the intact leukocytes using Trizol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommendation (see Notes 3-5). Other commercially available kits for RNA isolation also produce good quality RNA for TaqMan RT-PCR.

1. Working one tube at a time, add 1 mL of Trizol reagent and immediately vortex until homogeneous, typically for 15 s (or until solution looks transparent).

2. For large cell pellets, dissolve as much as possible in 1 mL of Trizol. If necessary, add more Trizol and vortex until homogeneous; then transfer 1 mL of sample into a prelabeled sterile 2-mL tube for RNA extraction. The remaining can be left in the 15-mL tube and stored as a bulk sample at -70°C for future use. Follow the manufacturer's recommendations to complete the RNA isolation process.

3. Use 1 |L of RNA to check the integrity of RNA by gel electrophoresis before reverse transcription.

4. The concentration of the RNA can be determined by absorbance at 260 nm using a spectrophotometer.

5. After taking the required aliquots for QC gel and quantitation (approx 4 |L), store the remaining RNA at -70°C until further use. For long-term storage, keep RNA pellet in 100% ethanol at -70°C. Avoid frequent freezing and thawing.

3.3. RNA Quality Determination by Gel Electrophoresis

The quality of RNA is important for accurate quantification and can be assessed by simple gel electrophoresis (see Notes 6 and 7). Observing the presence of 28S and 18S ribosomal RNA molecules, which separate as discrete 4.5- and 1.9-kb bands, respectively, on an ethidium stained agarose gel (1%) is a good indication of intact RNA (see Notes 8 and 9). Proceed to reverse transcription if quality of RNA is acceptable.

3.4. Reverse Transcription of RNA to cDNA Using Random Hexamers

Fourteen micrograms of total RNA from each sample is then converted to cDNA in a final volume of 60 |L using random hexamers and Superscript II reverse transcription (Invitrogen, Lifetechnologies) according to the recom mendations of the manufacturer (see Note 10). In hypocellular samples with less RNA, the final volume of cDNA reaction is adjusted accordingly. cDNA is stored at -20°C until further use. Unused RNA is stored at -80°C for future use. Dilutions of RNA from bcr-abl positive cell line controls into a bcr-abl negative cell line, HL-60 (1:10,000 and 1:100,000) are used as controls for reverse transcription.

3.5. TaqMan RT-PCR Assay for bcr-abl

Taqman RT-PCR assay can be performed using either the ABI PRISM® 7700 or 7900HT Sequence Detection System (ABI). 5.0 |L of cDNA from each sample is subjected to amplification in duplicate for bcr-abl in a multiplex RT-PCR using an abl reverse primer, 5'-NED-TCC AAC GAG CGG CTT CAC-3' in combination with bcr b2, 5'-TGC AGA TGC TGA CCA ACT CG-3' and bcr e1,5'-ACC GCA TGT TCC GGG ACA AAA -3' forward primers, and a FAMlabeled abl probe, 5'- FAM-CAG TAG CAT CTG ACT TTG AGC CTC AGG GTC T-TAMRA-3'. For size analysis of fusion transcripts by capillary electrophoresis, the abl primer is labeled with NED fluorescent dye at its 5'-end. The bcr-abl PCR assay is performed in a final volume of 25 | L using universal master mix without UNG (ABI) with 400 nM of each primer and 200 nM of FAM-labeled bcr-abl probe (see Note 11).

Amplification of abl is performed simultaneously in duplicate, but in a separate reaction as an amplification control and to normalize bcr-abl values. Amplification for abl is performed using 5 | L of cDNA in a final volume 25 |L, using 100 nM of abl forward primer, 5'-GTC TGA GTG AAG CCG CTC GT-3', 100 nM of abl reverse primer, 5'-GGC CAC AAA ATC ATA CAG TGC A-3', and 200 nM of VIC®-labeled abl TaqMan probe, 5'-VIC-TGG ACC CAG TGA AAA TGA CCC CAA CC-TAMRA-3'.

Plasmid standards are run in duplicate simultaneously with patient samples to generate standard curves for bcr-abl and abl (normalizer). If plasmid is unavailable to construct standard curves, a positive cell line such as K562 can be used to generate a standard curve. In addition to the plasmid dilutions used to derive the standard curve, dilutions of RNA from bcr-abl positive cell line controls into a bcr-abl negative cell line, HL-60 (1:10,000 and 1:100,000) are amplified with each run as a control for reverse transcription and the PCR reaction. The assay should be repeated if fusion transcripts are not detected at these levels.

For bcr-abl and abl amplifications, samples are subjected to 40 cycles of PCR, each cycle consisting of denaturation at 95°C for 30 s, annealing at 57°C for 20 s and extension at 72°C for 45 s. The last cycle is followed by a 10-min elongation step at 72°C. Follow the steps described next for PCR setup.

1. Sterilize the PCR set up hood with 75% ethanol before use.

2. Set up optical tubes in ascending numerical order. Each sample should be run in duplicate. The last sample should be followed by a positive control, negative control, and no template reagent control.

3. Add a 20.0-|L aliquot of universal master mix to each PCR reaction tube.

4. Add 5.0 |L of the appropriate cDNA sample to each PCR reaction tube. The total reaction volume at this point should be 25 |L per tube.

5. Tap vortex the tubes briefly and quick-spin in microcentrifuge.

6. Immediately place the PCR tube in 7700 or 7900 ABI.

7. Verify that the thermal-cycler conditions are correct, then start the PCR cycle by selecting "show analysis" and pressing the RUN button. It will take about 2 h to finish.

8. After the PCR is complete, save the data. Remove tray from thermal-cycler and place in -20°C until ready to be analyzed on an ABI PRISM 3100, 310, or 3700 genetic analyzer.

3.6. Data Analysis

The fluorescence emission data for each sample can be analyzed immediately after PCR using Sequence Detection Software (SDS v1.7, ABI). The threshold cycle values representing the PCR cycle number at which fluorescence signal is increased above an arbitrary threshold are exported into Microsoft Excel® software for further analysis. Using the standard curves, quantitative levels of abl and bcr-abl and abl are calculated for each patient sample (see Notes 12 and 13). One way to express the bcr-abl levels for each sample is as a ratio of bcr-abl to abl, that can be multiplied by 100 to generate a percentage.

3.7. Capillary Electrophoresis and GeneScan Analysis

Following real-time reverse transcription PCR, each amplification product is subjected to capillary electrophoresis in an ABI PRISM 3100 Genetic Analyzer (ABI). Other ABI capillary instruments can be used if the ABI PRISM 3100 Genetic Analyzer is unavailable. The ABI PRISM 3100 Genetic Analyzer is a laser-based fluorescence detection system that automatically introduces the samples labeled with fluorescent dyes into a polymer-filled capillary for electrophoresis. The CTS-ROX 50-500 DNA ladder (Bio Venture, Murfreesboro, TN) is used as internal size standards. The size of each amplified fragment is calculated with GeneScan software (ABI) using the Local Southern sizing option (Fig. 2). The steps involved in capillary electrophoresis are as follows:

1. Make a 1:20 dilution of the PCR product with water (see Note 14).

5000 aOOO 3000 2000 1000 o

6000 <9000 2000 0

-looo 2000 0

3000 2000 1000 o

Electropherogram

Size in Basepairs

150 175 200 225

Electropherogram

Size in Basepairs

150 175 200 225

•_■_ _-_._^_-_■_)

264 bp

K562

L

1 133 bp

HL60

*_i_• A_n_n

2. Prepare a 96-well plate adding 12.5 |L of the following mix to desired wells: 0.05 ||L of CTS ROX 50-500 size standards and 12.45 ||L of deionized formamide for each sample.

3. If using ABI 3100 Genetic analyzer with 16 capillaries, the wells have to be filled in groups of 16 starting in well A1 to well B12. If there are not enough samples to fill a group of 15, add water or mix to the rest of the wells to complete the group.

5. Cover the plate and denature by heating at 95°C for 5 min followed by rapid cooling to 4°C.

6. Spin the plate to collect the product in the bottom of the wells. Be sure there are no bubbles on the bottom of the wells.

7. Load samples on the Genetic Analyzer for electrophoresis with POP-4 polymer.

3.7.1. 3100 Plate Setup

1. Open the Data Collection software and click on NEW to set up a new run. The plate editor box will open.

2. Name the plate and select the GeneScan and 96 well plate options.

3. Click FINISH.

4. Enter patient Sample/ID in the SAMPLE NAME column. Repeat for all patients.

5. Fill the rest of the columns as: BioLims Project: 3100_project; Dye Set: D; Run Module 1: GeneScan 36 POP4_Default Module; and Analysis Module 1: GS500 Analysis. Gsp.

The recovery of usable amounts of quality RNA is dependent primarily on handling and the quality of the sample received prior to extraction.

0 0

Post a comment