Introduction

Quantitation of gene expression, viral loads, infective agents, and transgenes have become an important aspect in molecular biology, especially in the rapidly growing fields of genomics and proteomics. In this context real-time poly-merase chain reaction (PCR) has rapidly developed into a powerful technology with high sensitivity and broad dynamic range (Fig. 1).

Reverse transcription of RNA followed by quantitative, fluorogenic, realtime PCR (qPCR) is commonly used to determine the number of messenger RNA (mRNA) transcripts in tissues and cells (1-3). Current qPCR or real-time PCR methods involve the use of various fluorescence techniques to detect amplified complementary DNA (cDNA) (1-10) and are distinguished by their excellent sensitivity and dynamic range (Fig. 1). These methods are simple compared to Northern blot analysis or in situ hybridization, detection of signal is linked in real-time to the PCR amplification, so no post-PCR procedures are required. In these methods, the amount of cDNA amplified in qPCR correlates

From: Methods in Molecular Biology, vol. 335: Fluorescent Energy Transfer Nucleic Acid Probes: Designs and Protocols Edited by: V. V. Didenko © Humana Press Inc., Totowa, NJ

Fig. 1. Comparison of methods to study gene expression. Advantage of real-time polymerase chain reaction for gene expression profiling in terms of dynamic range and sensitivity. NASBA, nucleic acid sequence-based amplification; XPLORE, based on Invader technology; TMA, transcription-mediated amplification; RPA, RNase protection assay; bDNA, branched DNA assay.

Fig. 1. Comparison of methods to study gene expression. Advantage of real-time polymerase chain reaction for gene expression profiling in terms of dynamic range and sensitivity. NASBA, nucleic acid sequence-based amplification; XPLORE, based on Invader technology; TMA, transcription-mediated amplification; RPA, RNase protection assay; bDNA, branched DNA assay.

with an increase in a fluorescent signal that results from an interaction between a fluorescent material and the other PCR reactants. The amount of starting DNA is then estimated by analyzing the fluorescence at each cycle of qPCR in real-time. A qPCR experiment may reliably discriminate between samples that have two- or threefold differences in transcript concentration over a broad dynamic range (1).

Several methods for the detection and quantitation of DNA and RNA based on real-time PCR coupled with fluorescence detection have been developed. The various kinds of fluorescent techniques used in qPCR may be applied successfully for various applications, but each has inherent strengths and weaknesses. Some DNA-binding dyes, such as SYBR® Green, fluoresce more brightly when they are bound to double-stranded DNA and have been used for real-time detection during PCR (8,9). The DNA-binding dyes, however, may alter the stability of the duplex DNA and facilitate the annealing of primers to nonspecific targets and the detection of primer artifacts like primer dimers (11). Furthermore, these dyes have limited use in multiplex qPCR, in which multiple target genes are amplified and detected in the same PCR reaction (see Subheading 4.1.). Other qPCR methods incorporate, in addition to both PCR primers, the use of an oligonucleotide probe labeled with a fluorophore and a quencher moiety (5-7). The quencher reduces the fluorescence of the fluorophore by fluorescence resonance energy transfer (12,13). During PCR, the fluorophore and quencher become separated causing a reduction in fluorescence resonance energy transfer and an increase in fluorescence. The separation of the two moieties occurs either by cleavage of the oligonucleotide (7) or by a change in secondary structure of the oligonucleotide probe when it anneals to target DNA, as occurs with molecular beacons (5,14). The probe-based techniques have complexities related to the kinetics of hybridization and amplification (7). Furthermore, dual-labeled oligonucleotides are expensive to produce. An alternative approach to the use of dual-labeled probes employs a fluorophore and quencher attached directly to the PCR primers instead of a hybridization probe (4,15). By excluding a probe from the reaction, this technique simplifies PCR kinetics.

A real-time qPCR technique that utilizes a fluorogenic-primer labeled with a single fluorophore was developed, in which no quencher is necessary (16,17). The counterpart PCR primer is unlabeled. The fluorogenic primer is designed to be "self-quenched" until it is incorporated into a double-stranded PCR product, when its fluorescence increases, i.e., is "dequenched." The fluorogenic primer is called a LUX primer (Light-Upon-eXtension). The design is based on studies that demonstrate the effects of the primary and secondary structure of oligonucleotides on the emission properties of a conjugated fluorophore (16). The design factors are largely based on the necessity of having guanosine bases in the primary sequence nearby the conjugated fluorophore (16). A number of other dyes are compatible with the LUX technology including FAM, JOE, HEX, TET, Alexa 546 (Molecular Probes), and Alexa 594 (Molecular Probes) Their emission and excitation spectra (Table 1) provide an excellent basis for multiplexing assays. The LUX format requires only two primer and one dye per target for multiplexing applications. The fluorophores used here are FAM and JOE. The previously mentioned characteristics and other standard characteristics of the primers, such as length and melting temperature, are included in the primer design by proprietary software, called LUX Designer (Invitrogen, Carlsbad, CA). These design rules enable the software to output primer pairs that are located throughout the target (input) sequence. Fluorogenic LUX primers are employed in PCR to discriminate 10-fold dilutions of cloned cDNA over a broad dynamic range (10-107copies). They provide a simple and effective alternative to present methods of fluorescence-based qPCR (17).

The LUX detection system can be used to investigate the gene expression patterns of the neural precursor cells P-19 as they undergo differentiation (18). The pluripotent mouse P-19 cell line is an excellent model to study expression of a suite of genes that are relevant for differentiation, because it will undergo a transformation from blast cell to neuronal and glial-like cell upon treatment with retinoic acid (19). The relative change in the amount of mRNA transcripts can be determined over the course of differentiation for various genes involved

Table 1

Examples of Fluorophores Compatible With LUX Technology

Dye Excitation/emission (nm)

FAM 492/520

JOE 520/548

TET 521/536

HEX 535/556

Alexa Fluor 546 554/570

Alexa Fluor 594 590/617

in neuronal function and stem cell differentiation. Quantitative reverse transcriptase (RT)-PCR with LUX primers can be performed using either single or multiplex assay. In addition, RNA transcribed in vitro can be to generate standard curves that have the potential to determine absolute copy number of transcripts in samples.

2. Materials

1. P-19 mouse embryonic carcinoma cell line (CRL-1825; American Type Culture Collection, Manassas, VA).

2. Standard growth medium a-minimum essential medium, 7.5% Donor Calf, and 2.5% fetal bovine serum (Gibco, Grand Island, NY). Differentiation medium: neurobasal medium, 2% B27 supplement, 0.5 mM l-glutamine (Gibco), 50 nM retinoic acid (Sigma, St. Louis, MO).

3. Templates for qPCR. Commercial RNA preparations (Stratagene, La Jolla CA, cat. nos. 776001 and 776009) and RNA isolated with the Trizol reagent (Invitrogen). In vitro transcribed RNA purified with the Micro-to-Midi Total RNA Purification System (Invitrogen).

4. Superscript III kit first strand synthesis kit and SuperMix UDG (Invitrogen) for reverse transcription and real-time PCR amplification.

5. Primers and probes. Fluorophore-labeled LUX primers and unlabeled primers designed by Web-based LUX Designer software (Invitrogen; http:// www.invitrogen.com/lux). Primers and probes for the 5' nuclease assays, designed by Primer Express software (Applied Biosystems). Labeled Probes supplied by Biosearch Technologies (Novato, CA).

6. ABI 7700 real-time PCR machine.

3. Methods

3.1. Growth and Differentiation of P-19 Cells

Culture P-19 mouse embryonic carcinoma cell line in standard growth medium a-minimum essential medium, 7.5% donor calf, 2.5% fetal calf serum

(Gibco BRL, Grand Island, NY). The P-19 mouse embryonic carcinoma cell line is pluripotent and differentiates into neuronal and glial cells in the presence of retinoic acid (19).

Induce cells to differentiate into neuronal-like cells by seeding them into Neurobasal medium, 2% B27 supplement, 0.5 mM L-glutamine (Gibco BRL) with 50 nM retinoic acid (Sigma) at 106 cells per 100 mm2 nonadhesive dish. Cells will form aggregates (embryoid bodies) within 24 h that grow larger over the course of the 4-d induction treatment (differentiation medium to be replaced after 2 d).

Dissagreagate the embryoid bodies with a pipetor, then vortex and replate the cells in poly-L-lysine coated six-well plate in differentiation medium without retinoic acid at 1 x 106 cells per well. Dissaggregated cells adhere to the culture surface and develop neuron-like processes that continue to grow over the 7-d differentiation period (medium without retinoic acid to be replaced after 4 d). The dissaggregated cells will assume various morphology types resembling neurons or glia, including bipolar cells, stellate cells, and round cells.

3.2. RNA Isolation

Isolate total RNA with Trizole reagent (Invitrogen) from cell cultures harvested just before the induction period in retinoic acid (time 0), during the 4-d induction period (1, 6, 48, and 96 h after retinoic acid induction) and during the differentiation period (1 h and 6 h and d 1, 3, 5, and 7 after retinoic acid withdrawal). RNA concentrations are measured by absorbance at 260 nM. Resulting RNA yields will increase steadily from 8 to 29 ^g per 1 x 106 million cells over the time course (time 0 to time 7 d).

3.3. Design LUX Primers

Obtain complete coding regions for the genes studied from Entrez-PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi) and paste into the sequence input field of the LUX Designer. The melting temperature of the LUX primers to be between 60 and 68°C as set by the default range of the LUX Designer software. Software lists several primer pairs located throughout each sequence. Primer pairs selected for study to be in the 3' part of the coding sequence (sequences in Table 2). In this way, design LUX primer pairs for a series of genes expected to be induced during the P-19 blast cell transformation. These include the neural genes, neuronal growth-associated protein (GAP)-43, glutamate receptor (GLUR)1, W-methyl-D-aspartate-type glutamate receptor (NMDA)1, y-aminobutyric acid (GABA) receptor B1a, choline acetyl-transferase (ChAT), and brain-derived neurotrophic factor (BDNF). Other primer pairs are generated for genes involved in differentiation processes.

Table 2

Fluorogenic LUX Primer Pairs Used for Quantitative RT-PCR

Table 2

Fluorogenic LUX Primer Pairs Used for Quantitative RT-PCR

Gene

Accession no.

3' pos

Labeled LUX primer

3' pos

Unlabeled counterpart

Prod

GABA-B1a

af114168

2295

cacgaaccttcttctcctccttcttcgtg

2243

Gctcttgggcttgggctttag

102

GLUR1

af_320126

4398

cacggttccagatcgtcttcctccgtg

4349

Ggacgacgatgatgacagcag

97

NMDA1

nm_008169

2569

ctacgagtggctggaggcatcgtag

2603

Ggcatccttgtgtcgcttgt

79

GAP-43

m16736

680

cactttctgaagccaaacctaaggaaagtg

713

caggcatgttcttggtcagc

83

ChAT

d12487

683

cagcctcagtgggaatggattggctg

615

tcggcagcacttccaagaca

114

BDNF

ay011461

729

gaacatagccgaactacccaatcgtatgttc

759

ccttatgaatcgccagccaat

82

GAPDH

nm_008084

632

cacgctctggaaagctgtggcgtg

657

accagtggatgcagggatga

69

EGR1

nm_007913

876

caacgagtagatgggactgctgtcgttg

779

agtggcctcgtgagcatgac

145

BMP4

s65032

1249

cacaatggctggaatgattggattgtg

1288

cagccagtggaaagggacag

86

BMP2-induced kinase

ay050249

5168

caccagttctgcgtggcatggtg

5138

ttgtctcctcctctgcaaactca

76

Nestin

af076623

5798

cagcccagagctttcccacgaggctg

5836

accctgtgcaggtggtgcta

84

Sequences for LUX primer pairs are given 5'-3'. The 3' position is noted owing to the nonspecific 5'-tail.

Sequences for LUX primer pairs are given 5'-3'. The 3' position is noted owing to the nonspecific 5'-tail.

These genes are early growth response factor (EGR)1, bone morphogenic protein (BMP)2-inducible kinase, BMP4, and nestin. The LUX primers for all gene targets are labeled with FAM, except the LUX primers for the reference gene glyceraldehyde-6-phosphate dehydrogenase (GAPDH), that are labeled with JOE to enable multiplex real-time PCR with a FAM-labeled LUX pair for a gene of interest.

3.4. cDNA Synthesis and Real-Time PCR

First-strand cDNAs are synthesized from P-19 total RNA by reverse transcription (20- or 40-|L reaction volume) using the Superscript III kit first strand synthesis kit (Invitrogen) as indicated by the vendor. Real-time PCR with LUX primers performed using SuperMix UDG as instructed by the vendor and the LUX primer manual available at http://www.invitrogen.com/Content/sfs/ manuals/luxprimers_man.pdf.

Specifically, 20-|L reaction to be assembled as follows: 10 |L SuperMix UDG, 0.4 |L 10 |M forward primer, 0.4 |L 10 |M reverse primer, (0.4 |L 5 ||M probe for 5' nuclease assays), 4 |L cDNA (from reverse transcription), 0.4 |L ROX reference dye (Invitrogen), and DEPC water (Gibco) to 20 | L.

A 200-nM final concentration for each gene-specific primer (two pairs for multiplex PCR) is used. Note that the fluorophore for the labeled LUX primer is positioned either on the forward or the reverse primer during the LUX primer design process (Table 2).

Real-time PCR can be performed on standard instruments using the respective manuals. As an example, an ABI PRISM® 7700 sequence detector system (Applied Biosystems) is used with the following program: 50°C for 2 min and hold, 95°C for 2 min and hold. Then 40 cycles of: 95°C for 15 s, 55°C for 30 s, and 72°C for 30 s.

For melting curve analysis on this instrument, reactions are further incubated at 40°C for 1 min and then ramped to 95°C over a period of 19 min followed by incubation at 25°C for 2 min. Melting curve analysis is a rapid and powerful technique to analyze and verify the specificity of a real-time PCR assay. Melting curve analysis can identify nonspecific amplification and the presence of primer dimers by their different melting temperatures compared with the targeted amplicon. Real-time PCR with LUX fluorogenic primers is fully compatible with melting curve analysis. A typical result of melting curve analysis performed after the real-time PCR is shown in Fig. 2.

3.5. LUX Primers Validation

Validate the chosen LUX primers for gene expression experiments by determining PCR efficiency, specificity, and dynamic range using six serial 10-fold template dilutions. Brain and liver cDNA are used for this validation because the expression of some selected genes is very low in P-19 cells. The higher copy number of neuronal genes in brain allows for a range of input dilutions to generate the typical standard curves that are used in primer validation. RNA (500 ng) of mouse brain and liver is reverse transcribed and the resulting cDNA used for qPCR. All target genes to be amplified by PCR using three replicates per dilution and three replicates of no template controls. After analysis of results, cycle thresholds are (CT) typically between 15 and 33 cycles for all targets. The correlation coefficients (R2) for these linear plots to show an average of 0.993 (±0.005 SD, n = 11). The average slope of the CT vs initial-template plots are within -3.4 ± 0.17 SD and the PCR efficiencies (E = 10 exp [-1/ slope]; see ref. 20; user bulletin no. 2, Applied Biosystems, cat. no. 4303859) between 1.9 and 2.1 (average = 1.96 ± 0.06 SD). The ideal slope and PCR efficiency are -3.32 and 2.0, respectively. The efficiency of the GAPDH primer-PCR has to match that of the induced genes, to verify that relative inductions of target genes using GAPDH as the reference gene can be applied. The standard criteria for a validated set of primer pairs is when the plot of ACT (CTGAPDH-CT target gene) vs the log of the input amount of template has a slope of 0.1 or less (20) (user bulletin no. 2, Applied Biosystems, cat. no. 4303859). If a selected primer pair for a given gene does not qualify under this rule when compared to GAPDH, the induction of this gene can be calculated using an equation for efficiency correction (20,21). Quantitation by the calibration-curve method is another alternative that can be considered in this case (1,20).

The melting curve analysis for all LUX primers should show a single peak, which indicates a single PCR product. Typically there is no signal in the qPCR reactions (40 cycles) that do not include cDNA template, which indicates a lack of primer-dimer amplification. There should also be little or no amplification in the RT-PCR reactions that included RNA from liver as the starting template because of the low abundance of neural transcripts in liver tissue. Optional analysis of qPCR products from liver and brain samples by agarose gel electrophoresis to result in a single band of the expected size.

Use of the mono-labeled LUX primers is compatible with a wide variety of instruments including (but not limited to) the ABI qPCR instruments, Bio-Rad iCycler® iQ, Roche LightCycler™ (FAM label), Corbett Research RotorGene™, and the Stratagene Mx4000® and Mx3000P®. Real-time PCR with LUX primers followed by melting curves analysis provides a rapid and convenient tool to examine the specificity of the assays (Fig. 2). In Note 1, we outline a comparison of the LUX detection system with a multiplex approach and the 5' nuclease assay.

Fig. 2. Melting curve analysis of real-time polymerase chain reaction (PCR) with LUX primers. After amplification the instrument software is programmed to perform a slow ramp from low to high temperature during which double-stranded DNA dissociates into single-stranded DNA. Fluorescence signal is continuously recorded. (A) At the melting temperature of the amplicon (black lines), the fluorescent signal of the LUX dye decreases steeply. (B) The dissociation curve software usually can convert this drop into melting peaks by plotting the first derivative, -dF/dT, vs the temperature The highest point of this curve represents the melting temperature. The melting curve analysis of the controls without added template (gray lines) verifies that no PCR products were formed in these samples.

Fig. 2. Melting curve analysis of real-time polymerase chain reaction (PCR) with LUX primers. After amplification the instrument software is programmed to perform a slow ramp from low to high temperature during which double-stranded DNA dissociates into single-stranded DNA. Fluorescence signal is continuously recorded. (A) At the melting temperature of the amplicon (black lines), the fluorescent signal of the LUX dye decreases steeply. (B) The dissociation curve software usually can convert this drop into melting peaks by plotting the first derivative, -dF/dT, vs the temperature The highest point of this curve represents the melting temperature. The melting curve analysis of the controls without added template (gray lines) verifies that no PCR products were formed in these samples.

No Oj

3.6. In Vitro Transcribed RNA for Standardization

Choline acetyltransferase mRNA is transcribed in vitro from cDNA templates using T7 RNA polymerase (Invitrogen). Near full-length ChAT cDNA amplified from P-19 cell RNA using primers bearing topoisomerase I recognition sites (forward-5'-cggaacaagggggctgctgggatctgg; reverse-5'-tgagtcaagggctg agacggcggaaatta; underlined bases indicate the topoisomerase recognition site). A 5' T7 promoter and a 3' poly-A tail is joined to the cDNA by incubating the cDNA at 25°C for 5 min with the topoisomerase-charged TOPO Tools 5' T7 element and 3' Poly A element (Invitrogen). The molar ratio of cDNA needs to be twice that of each element. An antibody-based "hot-start," proofreading Taq DNA polymerase mixture (Platinum HiFi) is used to amplify full-length cDNA and to amplify the linear cDNA construct after topoisomerase-mediated linkage of the elements (Invitrogen, cat. no. 11304-011). The transcribed mRNA to be treated with DNase I (standard vendor protocol) to degrade the cDNA template. The mRNA is subsequently mixed with the lysis buffer, applied to a spin-column, washed and eluted with pure water (Micro-to-Midi Total RNA Purification System, Invitrogen). The transcription reaction typically yields 300 ng (5 x 20-|L reactions) after purification. The concentration of RNA and copy number is calculated by UV-absorbance. The transcript to show a single band of correct molecular weight by agarose gel electrophoresis. The ChAT mRNA generated by in vitro transcription can be used to determine the dynamic range for quantitative real-time RT-PCR, where the approximate initial copy number is known. For example serial threefold serial dilutions from 66 to 13 x 106 are used in a qPCR with LUX primers (Fig. 3A). A standard curve is plotted (Fig. 3B) and the CT values taken at various time points in the P-19 experiments can be compared to this standard curve in order to obtain absolute numbers in the induced samples (see Note 2).

3.7. Determination of Gene Expression Profiles of Selected Genes

The level of expression of the selected genes for each time point as shown in Fig. 4A,B to be determined by real-time fluorogenic qRT-PCR using a relative method of quantitation (20) (user bulletin no. 2, Applied Biosystems, cat. no. 4303859). The expression of the transcripts, NMDA, GABA, GLUR1, neural cell adhesion molecule, GAP-43, and ChAT, substantially increases during the differentiation period. The increase in BDNF, BMP2-inducible kinase, and BMP4 transcripts is typically moderate during the differentiation period, and EGR1 and nestin levels increase and then decrease during differentiation (18). For the P-19 expression experiments, the P-19 cell RNA (500 ng) from each time point is reverse transcribed (40-| L reactions) and the resulting cDNA (4 | L) to be used as a template for fluorogenic PCR (40 cycles). The RNA is

0 0

Post a comment