Preparation of Standard DNA

Generate the standard DNA for wild-type and mutant target sequences from cloned plasmid DNA containing pCR2.1-TOPO vector (Invitrogen) and PCR products of primers mtF3212 and mtR3471. The forward primer for generating the wild-type sequence is mtLF3212-3243A (5'-CACCCAAGAACA GGGTTTGTTAAGATGGCAGAGCCCG-3'), and the forward primer for generating the mutant target sequence is mtLF3212-A3243G (5'CAC CCAAGAACAGGGTTTGTTAAG ATGGCAGGGCCCG-3'). Measure the DNA concentration by DyNA Quant 200 fluorometer with Hoechst dye 33258. The copy number of the standard wild-type and mutant DNA sequence is calculated based on the size and DNA concentration of the plasmid DNA. Make serial dilutions of the standard DNA solution and perform the real-time qPCR reactions to construct the standard curve of the wild-type and the mutant DNA (Figs. 1 and 2).

Fig. 1. (opposite page) Amplification and standard curves of TaqMan® assays. The left panels depict the amplification curves and right panels depict the corresponding standard curve. The five curves from left to right represent the amplification of the standard DNA solutions containing 400,000, 40,000, 4000, 400, and 40 copies, respectively, of the wild-type A3243 mitochondrial DNA (mtDNA) (A1) and 100,000, 10,000, 1000, 100, and 10 copies, respectively, of mutant A3243G mtDNA (B1). Each amplification curve contains duplicate measurements. (Please see Companion CD for a color version of this figure.)

Cyete

Cyete

i i i iiiiii—i i 11 hi—i i i iiiiii—i ■ i nun—i i 11 mil 10*1 10*2 10*3 10*4 10-5 10*t

Correlation Coeff:

i i i iiiiii—i i 11 hi—i i i iiiiii—i ■ i nun—i i 11 mil 10*1 10*2 10*3 10*4 10-5 10*t

Starting Quantity

Cyc le

Cyc le

i n mi—i i 11 in—i i i iiiiii—i i i iiiiii—i i 11 mi 10*2 10*3 10*4 10*5 10*6

Starling Quantity

i n mi—i i 11 in—i i i iiiiii—i i i iiiiii—i i 11 mi 10*2 10*3 10*4 10*5 10*6

Starling Quantity

10* t

50.00

:

40.00 3500

10-0

i

Jf

tfmmr fflWrf

u

1!|L_

..L _ll

:

4T

"H'TTTJn' "i——*—

' / -

5 2 n

30.00 25.00 20.00

-

r HI

Trn—pr-

i-<

10'-1

_

II iff ■ # jfii

fctyrM

||—

1

-

li^TljffilJr

15.00

TTitr"

i,* "

TTTl^ili ■ irf :

E

10.00 5.00

t0'-2

:

5

a

ti *f! ¡'1 n

i

-

Slope:

-3.39

3

33

000 -5,00

Correlation Coeff: 1.000

Till 11

1 1 II Hill

ilium i

riuini

i rirmi

i n i ii in ii

uim

1111

Till

0 2

A

6

8

to

12

14

16 IS 20 22 24 26 28 30 32 34 36 38 40 42 44

10*1

10*2

10'3

10*4

10'5

10*6

10*7

Cye 1«

Starting Quantity

10*1

:

50.00

:

45.00

'

"tttt

Mis f LT ^

40.00 35.00

10'0

:

i ■ ■■ t : jr fflBftft

^ 0

||—U-

:

\\n 1 IT -f1-

50 00

nrr

£JI

■ *

0

25.00

,* . 7. L

4

IO--1

=

=R=|=

4SMug ri'x^rrTiTTT*

1 1 1 , 1 1 II

2 0 £

20.00 15.00 10.00

hit

flp

;

MPT «

4> *

1!

1 1

5 00 0.00

nnrrplatinn

10-2

!

4

k

s

■1

if

^npff- n qqq

-

rrr

rr

±1 n

-1

-i

1

-TT

T 1 1 i II 1

111 i i 11 Itri'tT

1111i Hn

-5.00

■ i mnnr

—rr

TTTir

i r rirttii inmnr

i 11 linn

rrm

rrm

0 2

4

6

0

10 12 14

6 18 20 22 24 24 28 SO 32 W 36 36 40 42 44

TO* 1

10" 2

0*3

10*4

0*5

10*6

Cycle

Starting Quantity

3.3. Generation of DNA Fragment Containing Wild-Type or Mutant Sequence by PCR

1. Set up the following PCR reaction:

Reagent Volume/reaction (||L) Final concentration

GeneAmp 10X PCR buffer II 5

dNTPs (8 mM each) 1.25 mtLF3212-3243A (10 |M) or mtF3212-3243G (10 |M) 1

mt3319R (10 |M) 1 Sterile distilled water add to 49.8

AmpliTaqGold DNA 0.2 polymerase (5 |L/||L)

Total volume 50

2. PCR conditions are as follows:

b. 95°C, 40 s; 55°C, 30 s; 72°C, 30 s; x 30 cycles.

3.4. Preparation of Standard DNA by Cloning the PCR Product to Plasmid

3.4.1. Cloning

1. Mix gently 2 |L of fresh PCR product with 1 |L of the salt solution, 2 |L sterile water, and 1 |L TOPO vector (all from TOPO TA Cloning Kit) in a 1.5-mL Eppendorf tube.

2. Incubate the reaction mixtures at room temperature (22-23°C) for 5 min.

3. Place the reaction mixture on ice and proceed to the One Shot Chemical Transformation or store the TOPO cloning reaction at -20°C overnight.

200 nM 200 nM

Fig. 2. (opposite page) Amplification and standard curve of ARMS qPCR SYBR® Green assays. The figure is similar to Fig. 1, except that SYBR Green is used to detect the PCR products. The standard DNA solutions used for the amplification curves, from left to right, contain 1 million, 100,000, 10,000, 1000, 100, and 10 copies, respectively; of the wild-type DNA (A1), and 600,000, 60,000, 6000, 600, 60, and 6 copies, respectively, of mutant DNA (B1). (Please see Companion CD for a color version of this figure.)

3.4.2. One Shot Chemical Transformation

1. Add 2 pL of the TOPO Cloning reaction containing PCR product from Subheading 3.4.1. into a vial of One Shot Chemically Competent Escherichia coli and mix gently. Do not mix by pipetting up and down.

2. Incubate on ice for 5-30 min. Longer incubations on ice do not seem to have any effect on transformation efficiency.

3. Heat-shock the cells for 30 s at 42°C without shaking.

4. Immediately transfer the tubes to ice.

5. Add 250 pL of room temperature SOC medium.

6. Cap the tube tightly and shake the tube horizontally (200 rpm) at 37°C in the New Brunswick Innova 4300 Incubator Shaker for 1 h.

7. Spread 10 pL and 50 pL from each transformation onto each prewarmed plate containing 100 pg/mL ampicillin for selection and incubate overnight at 37°C. Plate two different volumes to ensure that at least one plate will have well-spaced colonies. An efficient TOPO Cloning reaction will produce hundreds of colonies.

8. Pick two to three white colonies and put each colony into 5 mL LB medium containing 100 pg/mL of ampicillin. Shake overnight at 37°C. The colonies are ready for plasmid DNA isolation.

3.4.3. Verification

1. Isolate the plasmid DNA using QIAprep Spin Miniprep Kit.

2. Digest the plasmid DNA with EcoR I. If there is a DNA insert, two DNA fragments will be generated vs a linearized vector without an insert. Alternatively, the sequence of the inserted DNA can be verified by direct DNA sequencing using M13 forward (-20) and M13 reverse primers included in the PCR 2.1 TOPO cloning kit.

3.4.4. Quantification

Determine the concentration of plasmid DNA by using either DyNA Quant 200 fluorometer with Hoechst dye 33258 or Beckman Coulter's DU 640 Spec-trophotometer. Calculate the copy number of the standard wild-type and mutant DNA sequence based on the size and molecular weight of the plasmid DNA by the formula: plasmid DNA copy number (molecules/mL) = 4.56 x 1013 (molecules/mL) / [size (kb) of plasmid DNA containing inserted target sequence] x [DNA concentration (pg/mL)/50 (pg/mL)] (12).

0 0

Post a comment