Reagents

1. ET-labeled primers (available from Chemicon, Tenecula, CA; cat. no. S7908, as Amplifluor primers for SNP genotyping), 50 mM solutions in water. These two primers have the following sequences (9):

5'-F-AGCGATGCGTTCGAGCATCGCT*GAGGGTGACCAAGTTCATGCT 5'-SR-AGGACGCTGAGATGCGTCCT*GAAGGTCGGAGTCAACGGATT where F is fluoresceine, SR is sulforhodamine, and T* indicates a thymidine with a dabsyl quencher tethered to C5. For ABI instruments, Sulforhodamine is replaced by JOE (ABI, cat. no. 7909).

2. 20X SNP-specific primer mixture: allele-specific primers, 5 mM each, and common reverse primer, 7.5 mM. Primer design is described in Subheading 3.1.

3. 10X PCR buffer: 100 mM Tris-HCl, pH 8.3, 500 mM KCl, 18 mM MgCl2, 0.5% each of Tween-20 (peroxide-free, Sigma, St. Louis, MO; cat. no. P6585) and Igepal CA-630 (Sigma, cat. no. I3021). Prepare the 10X buffer by mixing/dissolving Molecular Biology grade components from Sigma and filter through 0.2-mm filter.

Fig. 1. Principle of the assay with universal energy-transfer-labeled primers (see Heading 1.).

4. dNTPs, PCR grade (Amersham Biosciences, Piscataway, NJ), 25 mM each; solution in water.

5. Hot-start Taq DNA polymerase: Titanium™ Taq (BD-Clontech, Palo Alto, CA), Platinum® Taq (Invitrogen, Carlsbad, CA), or JumpStart (Sigma).

6. DNA samples: the following QIAamp™ DNA blood kits from Qiagen (Valencia, CA) are recommended for DNA sample preparation (cat. nos. 51104, 51106, 51183, 51185, 51192, 51194, 51161, or 51162). The concentration of the DNA sample to be used in the PCR reactions should be 1-10 ng/mL. For each PCR reaction, it is recommended to use 4-10 ng total DNA.

7. Reference DNA samples: for assay development and/or as positive controls, use DNA samples from Coriell Institute for Medical Research (Camden, NJ), or similar high-quality DNA.

8. Molecular Biology grade water (Sigma or of equal quality).

9. Optional: 25 or 50 mM MgCl2 solution in water, Molecular Biology grade, (Sigma).

10. Optional: 5 M betaine solution in water (Sigma, cat no. B0300).

11. Thin-wall PCR microplates, such as Abgene (Rochester, NY) AB-0600 PCR plates. A plate reader that reads the plate from the top will require a transparent plate seal, such as Cycle Seal™ Plate Sealer (Robbins Scientific, Sunnyvale, CA; cat. no. 1044-39-4). Nontransparent seals can be used with bottom reading plate readers.

0 0

Post a comment