Ystr Allele Nomenclature

The DNA Commission of the International Society of Forensic Genetics (ISFG) has made a series of recommendations on the use of Y-STR markers (Gill et al. 2001). Their recommendations address allele nomenclature, use of allelic ladders, population genetics, and reporting methods.

The ISFG recommendations for Y-STR allelic ladders include the following: (a) the alleles should span the distance of known allelic variants for a particular locus, (b) the rungs of the ladder should be one repeat unit apart wherever possible, (c) the alleles present in the ladder should be sequenced, and (d) the ladders should be widely available to enable reliable inter-laboratory comparisons. The existence of commercially available Y-STR kits has now facilitated the widespread use of consistent allelic ladders (see above).

Unfortunately, because various researchers in the field have taken different approaches to naming Y-STR alleles there are instances of multiple designations for the same allele. An example of this phenomenon that illustrates the importance of standardization is DYS439, which has been called three different ways in the literature (Figure 9.8).

In an effort to provide a unified nomenclature for STR loci, a comparative analysis of the repeat and sequence structure of Y chromosome markers in humans and chimpanzees has been proposed and 11 human Y-STRs have been

(a) ATCTATCTTGAATTAATAGATTCAAGGTGATAGATATACAGATAGATAGA TACATAGGTGGAGACAGATAGATGATAAATAGAAGATAGATAGATAGAT AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA

Was this article helpful?

0 0
Stuttering Simple Techniques to Help Control Your Stutter

Stuttering Simple Techniques to Help Control Your Stutter

Discover Simple Techniques to Help Control Your Stutter. Stuttering is annoying and embarrassing. If you or a member of your family stutters, you already know the impact it can have on your everyday life. Stuttering interferes with communication, and can make social situations very difficult. It can even be harmful to your school or business life.

Get My Free Ebook


Post a comment