Diversity and Natural Selection

Biologists have long been fascinated by the diversity of life. The amazing variety of living things makes it natural to wonder how so many different life-forms came to be. Physical characteristics that could be easily observed, such as the shape of wing, the structure of a shell, or the size of a beak, provided the first means to search for an answer. Recognition of the variation within a species (imagine a Chihuahua and a Great Dane) led Charles Darwin to propose that new species emerge when selection favors certain traits within a population.

Today's biologists continue to study the effects of natural selection on the evolution of species, but they are no longer limited to beak size and wing shape. Now they can compare the positions of genes on chromosomes, the amino acid sequences of proteins, and the nucleotide sequences of genes. With DNA or protein sequences from over 133,000 species represented in the taxonomy database at the National Center for Biotechnology Information (NCBI) and over 800 genome sequences either published or in progress, researchers have an unprecedented opportunity to study evolution at a molecular level.

CAAAGCTCTTGCT TTGACAATTTTGGTCTTT---CAGAA-TACTATAAAT human

CAAAGTTGTAGTCTTGACAATTCTGCTCTTT---ACATA-AAATTGAAGC rabbit

CAAAATTGTAGCCCTGACAATTTGACTCCTTTTACAAGA-AAATATAGGA cow

0 0

Post a comment