H3c

FIGURE 8-42 Three regulatory nucleotides.

certainly not unique in the amount of potential binding energy it can contribute. The importance of adenosine probably lies not so much in some special chemical characteristic as in the evolutionary advantage of using one compound for multiple roles. Once ATP became the universal source of chemical energy, systems developed to synthesize ATP in greater abundance than the other nu-cleotides; because it is abundant, it becomes the logical choice for incorporation into a wide variety of structures. The economy extends to protein structure. A single protein domain that binds adenosine can be used in a wide variety of enzymes. Such a domain, called a nucleotide-binding fold, is found in many enzymes that bind ATP and nucleotide cofactors.

Some Nucleotides Are Regulatory Molecules

Cells respond to their environment by taking cues from hormones or other external chemical signals. The interaction of these extracellular chemical signals ("first messengers") with receptors on the cell surface often leads to the production of second messengers inside the cell, which in turn leads to adaptive changes in the cell interior (Chapter 12). Often, the second messenger is a nucleotide (Fig. 8-42). One of the most common is adenosine 3',5'-cyclic monophosphate

(cyclic AMP, or cAMP), formed from ATP in a reaction catalyzed by adenylyl cyclase, an enzyme associated with the inner face of the plasma membrane. Cyclic AMP serves regulatory functions in virtually every cell outside the plant kingdom. Guanosine 3',5'-cyclic monophosphate (cGMP) occurs in many cells and also has regulatory functions.

Another regulatory nucleotide, ppGpp (Fig. 8-42), is produced in bacteria in response to a slowdown in protein synthesis during amino acid starvation. This nu-cleotide inhibits the synthesis of the rRNA and tRNA molecules (see Fig. 28-24) needed for protein synthesis, preventing the unnecessary production of nucleic acids.

SUMMARY 8.4 Other Functions of Nucleotides

■ ATP is the central carrier of chemical energy in cells. The presence of an adenosine moiety in a variety of enzyme cofactors may be related to binding-energy requirements.

■ Cyclic AMP, formed from ATP in a reaction catalyzed by adenylyl cyclase, is a common second messenger produced in response to hormones and other chemical signals.

Key Terms

Terms in bold are defined in the glossary. gene 273

ribosomal RNA (rRNA) 273 messenger RNA (mRNA) 273 transfer RNA (tRNA) 273 nucleotide 273 nucleoside 273 pyrimidine 273 purine 273

deoxyribonucleotides 274 ribonucleotide 274 phosphodiester linkage 277

5' end 277 3' end 277 oligonucleotide 278 polynucleotide 278 base pair 279 major groove 282 minor groove 282 B-form DNA 284 A-form DNA 284 Z-form DNA 284 palindrome 285

hairpin 285 cruciform 285

triplex DNA 286 G tetraplex 287 H-DNA 287

monocistronic mRNA 287 polycistronic mRNA 288 mutation 293 second messenger 302 adenosine 3',5'-cyclic monophosphate (cyclic AMP, cAMP) 302

General

Chang, K.Y. & Varani, G. (1997) Nucleic acids structure and recognition. Nat. Struct. Biol. 4 (Suppl.), 854-858.

Describes the application of NMR to determination of nucleic acid structure.

Friedberg, E.C., Walker, G.C., & Siede, W. (1995) DNA Repair and Mutagenesis, W. H. Freeman and Company, New York. A good source for more information on the chemistry of nucleotides and nucleic acids.

Hecht, S.M. (ed.) (1996) Bioorganic Chemistry: Nucleic Acids, Oxford University Press, Oxford. A very useful set of articles.

Kornberg, A. & Baker, T.A. (1991) DNA Replication, 2nd edn, W. H. Freeman and Company, New York.

The best place to start to learn more about DNA structure.

Sinden, R.R. (1994) DNA Structure and Function, Academic Press, Inc., San Diego.

Good discussion of many topics covered in this chapter.

Historical

Judson, H.F. (1996) The Eighth Day of Creation: Makers of the Revolution in Biology, expanded edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Olby, R.C. (1994) The Path to the Double Helix: The Discovery of DNA, Dover Publications, Inc., New York.

Sayre, A. (1978) Rosalind Franklin and DNA, W. W. Norton & Co., Inc., New York.

Watson, J.D. (1968) The Double Helix: A Personal Account of the Discovery of the Structure of DNA, Atheneum, New York. [Paperback edition, Touchstone Books, 2001.]

Variations in DNA Structure

Frank-Kamenetskii, M.D. & Mirkin, S.M. (1995) Triplex DNA structures. Annu. Rev. Biochem. 64, 65-95.

Herbert, A. & Rich, A. (1996) The biology of left-handed Z-DNA. J. Biol. Chem. 271, 11,595-11,598.

Htun, H. & Dahlberg, J.E. (1989) Topology and formation of triple-stranded H-DNA. Science 243, 1571-1576.

Keniry, M.A. (2000) Quadruplex structures in nucleic acids. Biopolymers 56, 123-146.

Good summary of the structural properties of quadruplexes.

Moore, P.B. (1999) Structural motifs in RNA. Annu. Rev Biochem. 68, 287-300.

Shafer, R.H. (1998) Stability and structure of model DNA triplexes and quadruplexes and their interactions with small ligands. Prog. Nucleic Acid Res. Mol. Biol. 59, 55-94.

Wells, R.D. (1988) Unusual DNA structures. J. Biol. Chem. 263, 1095-1098.

Minireview; a concise summary.

Nucleic Acid Chemistry

Collins, A.R. (1999) Oxidative DNA damage, antioxidants, and cancer. Bioessays 21, 238-246.

Marnett, L.J. & Plastaras, J.P. (2001) Endogenous DNA damage and mutation. Trends Genet. 17, 214-221.

ATP As Energy Carrier

Jencks, W.P. (1987) Economics of enzyme catalysis. Cold Spring Harb. Symp. Quant. Biol. 52, 65-73.

A relatively short article, full of insights.

Problems

1. Nucleotide Structure Which positions in a purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

2. Base Sequence of Complementary DNA Strands

One strand of a double-helical DNA has the sequence (5')GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?

3. DNA of the Human Body Calculate the weight in grams of a double-helical DNA molecule stretching from the earth to the moon (~320,000 km). The DNA double helix weighs about 1 X 10~18 g per 1,000 nucleotide pairs; each base pair extends 3.4 A. For an interesting comparison, your body contains about 0.5 g of DNA!

4. DNA Bending Assume that a poly(A) tract five base pairs long produces a 20° bend in a DNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA) 5 tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helix.

5. Distinction between DNA Structure and RNA Structure Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the helical structure of a long and fully base-paired (except at the end) hairpin in RNA different from that of a similar hairpin in DNA?

6. Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a GqC (not A=T) base pair. This G-T mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Can you suggest why cells might require a specialized system to repair G-T mismatches?

7. Nucleic Acid Structure Explain why the absorption of UV light by double-stranded DNA increases (hyperchromic effect) when the DNA is denatured.

8. Determination of Protein Concentration in a Solution Containing Proteins and Nucleic Acids The concentration of protein or nucleic acid in a solution containing both can be estimated by using their different light absorption properties: proteins absorb most strongly at 280 nm and nucleic acids at 260 nm. Their respective concentrations in a mixture can be estimated by measuring the absorbance (A) of the solution at 280 nm and 260 nm and using the table below, which gives R280/260, the ratio of absorbances at 280 and 260 nm; the percentage of total mass that is nucleic acid; and a factor, F that corrects the A280 reading and gives a more accurate protein estimate. The protein concentration (in mg/ml) = FX ^280 (assuming the cuvette is 1 cm wide). Calculate the protein concentration in a solution of A280 = 0.69 and A260 = 0.94.

Proportion of

R28o/26o nucleic acid (%) F

Weight Loss Funnel

Weight Loss Funnel

Who Else Wants To Discover The 3 Most Effective Fat Burning Methods The Weight Loss Industry Does NOT Want You To Know About.

Get My Free Ebook


Post a comment