Transposable elements

An unusual type of genetic transfer which takes place within an individual cell involves sequences of DNA called transposable elements. One type is known as an insertion sequence (IS), a relatively short piece of chromosomal or plasmid DNA which contains a gene for the enzyme transposase (Figure 11.34). This recognises, cuts and re-ligates the insertion sequence anywhere in the bacterial genome. In so doing, it may interrupt a gene sequence, and thereby cause a mutation. Unlike recombination events, no homology is required between the transposable element and the point at which it inserts. This relocation of a transposable element from one place in the genome to another is termed conservative transposition. In replicative transposition, the element remains in its original position and a copy is made and inserted elsewhere in the genome. Insertion sequences are flanked by inverted sequences some 9-41bp in length, which are thought to be essential for the recognition of the sequence by the transposase.

Transposable elements that also carry genes other than those required for transposition, such as genes for antibiotic resistance or toxins, are known as transposons.

Chromosomal DNA excised with prophage

Integrated prophage

Integration of phage and chromosomal genes into new host chromosome

Integrated prophage

Integration of phage and chromosomal genes into new host chromosome

Phage replication and packaging

Figure 11.33 Specialised transduction. During the replication cycle of a lysogenic bacteriophage, phage DNA is incorporated into the host chromosome (see Figure 10.11). When a lytic cycle resumes and the phage DNA is excised, it may take with it an amount of surrounding chromosomal DNA. This is packaged into phage particles and infects new host cells, where it is integrated into the bacterial chromosome. Only genes surrounding the site of phage integration may be transduced in this way

Phage replication and packaging

Cell lysis and release of phages

Figure 11.33 Specialised transduction. During the replication cycle of a lysogenic bacteriophage, phage DNA is incorporated into the host chromosome (see Figure 10.11). When a lytic cycle resumes and the phage DNA is excised, it may take with it an amount of surrounding chromosomal DNA. This is packaged into phage particles and infects new host cells, where it is integrated into the bacterial chromosome. Only genes surrounding the site of phage integration may be transduced in this way

Insertion sequence, IS 1

IR Transposase gene IR

5' GGTGATGCTGCCAACTTACTGAT 3' 5' ATCAATAAGTTGGAGTCATTACC 3'

3' CCACTACGACGGGTGAATGACTA 5' 3' TAGTTATTCAACCTCAGTAATGG 5'

Figure 11.34 Transposable elements. The insertion sequence IS 1 of E. coli is 768bp in length and is flanked by 23bp inverted repeat sequences. The IS contains the gene for a transposase enzyme, which catalyses the movement of the insertion sequence from one location to another. By integrating at random points in the genome where there is no sequence homology, IS sequences may disrupt functional genes and give rise to mutations

Was this article helpful?

0 0
Diabetes 2

Diabetes 2

Diabetes is a disease that affects the way your body uses food. Normally, your body converts sugars, starches and other foods into a form of sugar called glucose. Your body uses glucose for fuel. The cells receive the glucose through the bloodstream. They then use insulin a hormone made by the pancreas to absorb the glucose, convert it into energy, and either use it or store it for later use. Learn more...

Get My Free Ebook


Post a comment