A

'CAAAGATGATATTTTCTTTAATGGTG Wild Type probe TGATGACGCTTCTGTATCTATATTCATCATAGGAAACACA 3' ACTACTGCGAACACATAGATATAAGTAGTATCCTTTGTGGTTTCTACTATAAAAGAAATTACCACGGTCC 5' - 508wt

rCAATCATATTTTCTTTAATGGTGCCAG Mutant probe TGATGACGCTTCTGTATCTATATTCATCATAGGAAACACA 3' ACTACTGCGAAGACATAGATATAAGTAGTATCCTTTGTGGTTACTATAAAAGAAATTACCACGGTCCGTA 5' - AF508

Base Position: -1 12345678910

rCAATCATATTTTCTTTAATGGTGCCAG Mutant probe TGATGACGCTTCTGTATCTATATTCATCATAGGAAACACA 3' ACTACTGCGAAGACATAGATATAAGTAGTATCCTTTGTGGTTACTATAAAAGAAATTACCACGGTCCGTA 5' - AF508

Base Position: -1 12345678910

Fig. 3 Discrimination and detection of AF508 DNA. (A) AF508 assay design and alignment of WT, I506V, I507V, F508C, AF508, and AI507 DNA sequences. The wild-type (WT) probe is completely homologous to the WT target but mismatches at position 3, 7, and 10 on the respective targets F508C, I507V, and I506V. The Mutant (Mut) probe has a single mismatch at position 5 (underlined) on the AF508 target and two mismatches (positions 4 and 5) on the AI507 target. The position 5 mismatch was designed to reduce cross-reactive signal on the AI507 target, which differs from AF508 only at position 4. (B) The specific signal generated on WT, HET (WT/AF508), and Mut (AF508/AF508) genomic samples. The WT probe generates sufficient signal with the I507V and I506V targets (mismatches at positions 7 and 10, respectively), but not with the F508C target (mismatch at position 3). An additional test is required to determine F508C genotype. (C) The specificity of the Mut probe: the mismatch at position 5 does not hinder the signal generated from a AF508 HET genomic sample and creates additional discrimination of the AI507 genomic sample. (View this art in color at www.dekker.com.)

Fig. 3 Discrimination and detection of AF508 DNA. (A) AF508 assay design and alignment of WT, I506V, I507V, F508C, AF508, and AI507 DNA sequences. The wild-type (WT) probe is completely homologous to the WT target but mismatches at position 3, 7, and 10 on the respective targets F508C, I507V, and I506V. The Mutant (Mut) probe has a single mismatch at position 5 (underlined) on the AF508 target and two mismatches (positions 4 and 5) on the AI507 target. The position 5 mismatch was designed to reduce cross-reactive signal on the AI507 target, which differs from AF508 only at position 4. (B) The specific signal generated on WT, HET (WT/AF508), and Mut (AF508/AF508) genomic samples. The WT probe generates sufficient signal with the I507V and I506V targets (mismatches at positions 7 and 10, respectively), but not with the F508C target (mismatch at position 3). An additional test is required to determine F508C genotype. (C) The specificity of the Mut probe: the mismatch at position 5 does not hinder the signal generated from a AF508 HET genomic sample and creates additional discrimination of the AI507 genomic sample. (View this art in color at www.dekker.com.)

increases the assays' detection sensitivity in highly polymorphic genes or strains of infectious agents.

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment