Cln3

aTa=annealing temperature. bIn=intron.

cF=forward; R=reverse.

Exon 1 Inb0-51466Fc ctcggccagcggggtctgg 60

In1-52100R tcatatagcccagccgcagc

Exon 2-4 In1-56293F gataatgctgtttgaggcctcag 63

In4-57729R aagtctcttcctatgtctccagc

Exon 5 In4-59003F gatgaggatgctaaggatgaag 61

In5-59797R gccaggcgtagtggcgcatg

Exon 6-7 In5-68262F ggattacaggtgtgagccactg 63

In7-70422R agtgctgggattacaggcatgag

Exon 8 In7-71602F gctgacctctgtactcaacagtg 61

In8-72211R ccatattggacatgagtcaggtg

Exon 9 In8-74591F taatactcaggacaaactgcatta 60

In9-76322R ctacccatttcctgaggcctg

Exon 1-3 E1-754Fd cttgggaacccataaacaggacc 65

In3-2039R tctgacatgatcgccatcccatg

Exon 4-6 In3-2892F ggaaagcaatgaatgagggcaag 63

In6-3807R caggtggtaaggaattgaggaca

Exon 7-9 In6-3782F cagtgtcctcaattccttaccac 63

In9-4749R gaaaggtgtgtggttccacctg

Exon 10-13 In9-5064F ctccagcaagacctgggctata 64

In13-6249R ccaacagggcagaataagggac

Exon 1-2 E1-458F cctgccaatagatcattcccg 60

In2-1568R tcacttccctcttctcatgcc

Exon 3-4 In2-3452F cccaacattgaatgaggatgg 60

In4-4428R tcaggcaaggaccaggtgag

Exon 5-8 In4-5209F cctggaagctctgcggtcta 60

In6-6772R ctgaccttaggcgatctgcc

Exon 9 In8-8716F cttagaggcagtgagctacc 58

In9-9085R ccataaccagtacactcactc

Exon 10-13 In9-10203F tgcgtggtctggttaattgtg 60

In13-11034R caagattgcgctactgcactc

Exon 14-15 In13-15028F ggaggccacctctccttccc 63

In15-15798R gagaaatctgctgacataccttc

Exon 1 In0-105721F gagaggagacaggactggag 60

In1-107352R cagacagagaaggaaacgcgg

Exon 2 In1-117930F gacctctttgtggctaatctc 59

In2-118221R ggagaagtgacttgtctaagg

Exon 3 In2-122052F gacaagtccgttacctcctctg 60

In3-122652R ccttctacctgaacacctctc

Exon 4-5 In3-124746F tcacatactgtgacagaggtgg 62

In5-125545R gagctcacagtgcctttacag

Exon 6-7 In5-126797F gtaaactgtgacgtggcactc 60

In7-128637R actcatgctctcggtctctggtta

W.; Connell, F.; Zhong, N. Neuronal ceroid lipofuscinoses: Classification and diagnosis. Adv. Genet. 2001, 45, 1-34.

8. Autti, T.; Raininko, R.; Vanhanen, S.L.; Santavuori, P. MRI of neuronal ceroid lipofuscinosis. Cranial MRI of 30 patients with juvenile neuronal ceroid lipofuscinoses. Neuroradiology 1996, 38 (5), 476-482.

9. Seitz, D.; Grodd, W.; Schwab, A.; Seeger, U.; Klose, U.;

Nagele, T. MR imaging and localized proton MR spectroscopy in late infantile neuronal ceroid lipofuscinosis. Am. J. Neuroradiol. 1998, 19 (7), 1373-1377.

10. Wechsler, D. WISC-IV: Wechsler Intelligence Scale for Children, 4th Ed.; Psychological Corp.: San Antonio, TX, 2003.

11. Sheslow, D.; Adams, W.WRAML: Wide Range Assessment of Memory and Learning; Jastak Associates: Wilmington, DE, 1990.

12. Korkman, M.; Kirk, U.; Kemp, S. NEPSY: A Developmental Neuropsychological Assessment; Psychological Corp.: San Antonio, TX, 1998.

13. Lamminranta, S.; Aberg, L.; Autti, T.; Moren, R.; Laine, T.; Kaukoranta, J.; Santavuori, P. Neuropsychological test battery in the follow-up of patients with juvenile neuronal ceroid lipofuscinosis. J. Intellect. Disabil. Res. 2001, 45 (Part 1), 8-17.

14. Das, A.K.; Becerra, C.H.; Yi, W.; Lu, J.Y.; Siakotos, A.N.; Wisniewski, K.E.; Hofmann, S.L. Molecular genetics of palmitoyl-protein thioesterase deficiency in the U.S. J. Clin. Invest. 1998, 102 (2), 361-370.

15. van Diggelen, O.P.; Keulemans, J.L.; Winchester, B.; Hofman, I.L.; Vanhanen, S.L.; Santavuori, P.; Voznyi, Y.V. A rapid fluorogenic palmitoyl-protein thioesterase assay: Pre- and postnatal diagnosis of INCL. Mol. Genet. Metab. 1999, 66 (4), 240-244.

16. Sleat, D.E.; Donnelly, R.J.; Lackland, H.; Liu, C.G.; Sohar, I.; Pullarkat, R.K.; Lobel, P. Association of mutations in a lysosomal protein with classical late-infantile neuronal ceroid lipofuscinosis. Science 1997, 277 (5333), 18021805.

17. Junaid, M.A.; Sklower Brooks, S.; Wisniewski, K.E.; Pullarkat, R.K. A novel assay for lysosomal pepstatin-insensitive proteinase and its application for the diagnosis of late-infantile neuronal ceroid lipofuscinosis. Clin. Chim. Acta 1999, 281 (1-2), 169-176.

18. Zhong, N.A.; Wisniewski, K.E.; Ju, W.; Moroziewicz, D.N.; Jurkiewicz, A.; McLendon, L.; Jenkins, E.C.; Brown, W.T. Molecular diagnosis of and carrier screening for the neuronal ceroid lipofuscinosis. Genet. Test. 2000, 4 (3), 243-248.

19. Zhong, N. Neuronal ceroid lipofuscinosis and possible pathogenic mechanism. Mol. Genet. Metab. 2000, 71 (3), 195-206.

20. Savukoski, M.; Klockars, T.; Holmberg, V.; Santavuori, P.; Lander, E.S.; Peltonen, L. CLN5, a novel gene encoding a putative transmembrane protein mutated in Finnish variant late infantile neuronal ceroid lipofuscinosis. Nat. Genet. 1998, 19 (3), 286-288.

21. Ranta, S.; Zhang, Y.; Ross, B.; Lonka, L.; Takkunen, E.; Messer, A.; Sharp, J.; Wheeler, R.; Kusumi, K.; Mole, S.; Liu, W.; Soares, M.B.; Bonaldo, M.F.; Hirvasniemi, A.; de la Chapelle, A.; Gilliam, T.C.; Lehesjoki, A.E. The neuronal ceroid lipofuscinoses in human EPMR and mnd mutant mice are associated with mutations in CLN8. Nat. Genet. 1999, 23 (2), 233-236.

22. Gao, H.; Boustany, R.M.; Espinola, J.A.; Cotman, S.L.; Srinidhi, L.; Antonellis, K.A.; Gillis, T.; Qin, X.; Liu, S.; Donahue, L.R.; Bronson, R.T.; Faust, J.R.; Stout, D.; Haines, J.L.; Lerner, T.J.; MacDonald, M.E. Mutations in a novel CLN6-encoded transmembrane protein cause variant neuronal ceroid lipofuscinosis in man and mouse. Am. J. Hum. Genet. 2002, 70 (2), 324-335.

23. Wheeler, R.B.; Sharp, J.D.; Schultz, R.A.; Joslin, J.M.; Williams, R.E.; Mole, S.E. The gene mutated in variant late-infantile neuronal ceroid lipofuscinosis (CLN6) and in nclfmutant mice encodes a novel predicted transmembrane protein. Am. J. Hum. Genet. 2002, 70 (2), 537-542.

24. Teixeira, C.A.; Espinola, J.; Huo, L.; Kohlschutter, J.; Persaud Sawin, D.A.; Minassian, B.; Bessa, C.J.; Guimaraes, A.; Stephen, D.A.; Sa Miranda, M.C.; MacDonald, M.E.; Ribeiro, M.G.; Boustany, R.M. Novel mutations in the CLN6 gene causing a variant late-infantile neuronal ceroid lipofuscinosis. Human Mutat. 2003, 21 (5), 502-508.

25. Zhong, N. Molecular genetic testing for neuronal ceroid lipofuscinoses. Adv. Genet. 2001, 45, 141-158.

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment