Diagnosis Of Giardiasis

Common laboratory methods for diagnosis of giardiasis are designed for stool specimens. Samples are collected and preserved in 10% formalin, although fresh stools may

Fig. 1 Sequence alignment 5' end 16s rDNA. The alignment of the 290pb of group A, P-1 (Portland M54878), group B (U09491 and Bis/91/Hepu/1279 L-29192), and G. intestinalis isolated from symptomatic (1S, 4S, 5S, 6S, 7S, 8S, 9S) and asymptomatic children (1A, 2A, 3A, 4A, 5A, 6A).

p-l l29192

b is

5s es

7s 8s 9s 1a 2a 3a 4a 5a 6a p-l l29192

b is

6a p-l l29192

b is

6a p-l l29192

b is

6a p-l l29192

b is

* 20 * 40 * 60 catccggtcgatcctgccggagcgcgacgctctccccaaggacgaagccatgcatgccc

* 80 * 100 * 120 gctcacccgggacgcggcggacggctcaggacaacggttgcaccccccgcggcggtccct

* 140 * 160 * 180 gctagccggacäccgctggcaacccggcgccaagacgtgcgcgcaagggcgggcgcccgc

* 200 * 220 * 240 gggcgagcagcgtgacgcagcgacggcccgcccgggcttccggggcatcacccggtcgg

* 260 * 280 * cgcggtcgcggcgcgccgagggcccgacgcctggcggagaatcagggttcgact

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment