Methods for Pcrrflp and 16S rDNA Sequencing of Actinomyces Isolates

When an adequate and pure growth of the isolate has been cultured, genomic DNA may be extracted without the need for noxious chemicals or complex procedures. Boil a 1 mL loopful of the organism in 100 |L of Chelex resin (5%) for 8-10 min. Centrifuge at 13,000 rpm for 10 min. Use the supernate as target DNA. The almost complete 16S rRNA gene is amplified by PCR using ''universal'' primers pA (sequence AGAGTTTGATCCTGGCTCAG) and pH' (AAGGAGGTGATCCAGCCGCA) in 45 |L of reaction mixture containing 1 U of Taq polymerase, each deoxynucleoside triphosphate at 200 mM, 20 pmol of each primer, 2.25 mM magnesium chloride, 10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-100, and 5 |L of target DNA. For amplification, denature at 92°C for 2 min, anneal at 55°C for 1 min, and extend at 72°C for 1.5 min x 30 cycles with final extension for 5 min. Confirm the specific product of approximately 1600 bp by electrophoresis in 1% agarose using an appropriate molecular size marker. For DNA sequencing, purify the amplicon in a commercial PCR purification kit and proceed using a standard Taq dye-deoxy terminator sequencing kit and appropriate primers. For identification by PCR-RFLP, no purification step is necessary. Perform restriction endonuclease digestion by mixing 12.5 |L of PCR product with 1 |L of Haelll or Hpall (10 U/|L) and 1.5 |L of matched incubation buffer. Mix and incubate at 37°C for 1.5-2 hr. Add 3 mL of loading buffer to the reaction mix and electrophorese 12 mL of sample in a 3.5% Metaphor agarose gel in TAE buffer with ethidium bromide (0.5 |g/ mL) at 5 V/cm for 1.75 hr. Run appropriate size markers (e.g., 2 kb; Sigma, Poole, UK) at intervals alongside samples. Destain the gel in deionized water for 10 min and visualize under UV illumination. Analyze banding patterns by visual comparison with those of reference strains or, preferably, in a software package such as GelCompar (Applied Maths, Kortrijk, Belgium).[11]

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment