Molecular Characterization Of Giardia From Children And Animals

To characterize Giardia from humans and animals, fecal samples were obtained from six children with chronic recurrent diarrhea and abdominal pain, seven asymptomatic children, and three dogs. Controls were as follows: G. intestinalis group A Portland M54878; group B Belgian U09491; Bris/91/Hepu/1279 L29192; and dog 6 AF199449. DNA isolation was performed according to the phenol-chloroform-isoamilic alcohol method.[20] The gene 16S ribosomal RNA (ssRNA) fragment of 290pb was amplified by PCR using forward primer 5'-CATCCGGTCGATCCTGCC-3' and the reverse primer 5'-AGTCGAACCCTEATTCTCCGCCAGG-3', under conditions previously described.[21] The amplification products were purified using Qinquick kit (Qiagen). Double-stranded DNA sequencing was performed using the ABl Prism Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems) and a set of internal primers. Sequencing alignments of 16S rDNA was performed using clustal W, and a phylogenetic tree was designed using the neighbor-joining method and the phylogenetic distance 3.6 Phillip maximum likelihood (http:// www.igbmc.u-strasburg.fr/BioInfo). Analysis of the alignment of DNA sequences from symptomatic (5S, 6S, 7S, 8S, and 9S) and asymptomatic (1A, 2A, 3A, 4A, 5A, and 6A) children with giardiasis showed similarities to genotype group A DNA. However, these 11 sequences showed 37 variable sites when compared with group A (Figs. 1 and 2). Further analysis provided a phylogenetic tree with the following groups: one with samples 3A, 4A, and 5A; a second with 2A, 6A, 6S, and 9S; and a third with 1A, 5S, 7S, and 8S. Their sequences and the phylogenetic distances were very similar in samples from two symptomatic children (1S, 4S), seven axenic cultures

Fig. 2 Sequence alignment 5' end 16s rDNA. The alignment of the 290pb of group A, P-1 (Portland M54878), group B (U09491 and Bris/91/Hepu/1279 L-29192), and dog6 (AF199449). G. intestinalis isolated from symptomatic children and subjected to axenic cultures: IMSS-1, IMSS-2, IMSS-3, IMSS-4, INP-1, INP-3, INP-4 and 2dog, 3dog, 5dog.

* 20 * 40 * 60 CATCCGGTCGATCCTGCCGGAGCGCGACGCTCTCCCCAAGGACGAAGCCATGCATGCCC

Was this article helpful?

0 0
Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment