Molecular Methods

Molecular methods for the diagnosis of Giardia have been described. Polymerase chain reaction (PCR) technology offers alternatives to conventional diagnosis for both clinical and environmental purposes with 98.9% specificity. The PCR using the JW1 forward primer 5'GCGCACCAGGAATGTCTTGT 3' and the JW2 reverse primer 5' TCACCTACGGATACCTTGTT 3' DNA for amplification of 183pb showed a specificity of 100% when used to test samples from children who were immunocom-promised or who lacked the usual symptomatology. This is in contrast to 87% specificity when diagnoses were made by common laboratory methods.[12'13] Classification of subgroups of Giardia based on ribosomal RNA gene sequence using PCR, and genotype by conventional and real-time PCR/RFPL as well as ribosomal RNA gene sequence using PCR analysis, may facilitate studies of virulence, infectivity, and epidemiology of Giardian infection. Classification of subgroups of Giardia based on ribosomal RNA gene sequence using PCR analysis, and on genotype by conventional and real-time PCR/RFPL, may facilitate studies of virulence, infectivity and epidemiology Giardian of infection.

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment