Preparation of Target

Prepare DNA targets by polymerase chain reaction (PCR) amplification of the 189-bp region of the HLA-D gene (DNA isolates) using the 5' biotinylated primer sequences (forward primer: 5'CACCCATGAATTTGATGGAG; reverse primer: 5'TCATTGGTAGCAGCGGTAGAGTTG). PCR is performed in a total volume of 50 pL consisting of 10 mM Tris-HCl, pH 8.0, 50 mM KCl, 0.01% gelatin, b

Prot. Pos.

DQA1*010101

DQA1*010102

DQA1*010201

DQA1*010202

DQA1*0103

DQA1*010401

DQA1*010402

DQA1*0105

DQA1*0106

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment