Rapid Analysis of Sickle Cell Samples

A HyBeacon probe was designed to simultaneously detect and differentiate HbA, HbS, and HbC target sequences. The probe was designed to be fully complementary to the HbS sickle cell allele, possessing single and double nucleotide mismatches when hybridized to HbA and HbC sequences, respectively (Fig. 2). The sickle cell HyBeacon was synthesized using methods described previously.1-1,12-1 The probe sequence was 5'(GTGCACCTGACFCCTG-TGGP)3', where F and P were the FAM (6-carboxyfluo-rescein) labeled uracil and 3' phosphate, respectively. The FAM fluorophore was included at an internal position of the oligonucleotide, and the 3' phosphate was attached to prevent extension from probes during real-time PCR assays.

The HyBeacon probe was employed to detect a 139-bp amplicon containing the HbS and HbC loci. The sequences of the primers employed to amplify the probe target were 5'(AGGGCAGAGCCATCTATTGCT)3' and 5'(CATCCACGTTCACCTTGCC)3'. Target sequences were amplified from genomic DNAs extracted from 12 clinical samples supplied by the National Haemoglobin-

opathy Reference Service (John Radcliffe Hospital, Oxford, U.K.). Samples were analyzed with a Light-Cycler™ instrument using materials and methods described previously.1-1,2-1

Melting peak analysis was performed following PCR to determine the nature of amplified targets by means of probe Tm. HyBeacon probe hybridized to the fully complementary HbS allele generated melt peaks possessing Tms of approximately 58°C (Fig. 2). Hybridization to the HbA allele resulted in a T/T nucleotide mismatch between probe and target sequence, reducing the melting temperature to 52°C. Probe hybridization to the HbC allele resulted in T/T and G/T mismatches causing the Tm to drop to 48°C. Combinations of melt peaks enabled samples to be genotyped rapidly and reliably. Melt traces possessing only 58°C or 52°C peaks were identified as being homozygous HbS/S and HbA/A, respectively. Samples that generated both 58°C and 52°C peaks were similarly typed as heterozygous for HbS and HbC alleles, whereas those producing both 58 °C and 48 °C peaks were typed as compound heterozygotes possessing both HbS and HbC (Fig. 2). The 12 clinical samples, analyzed blind, were found to comprise triplicates of HbS/C, HbA/A, HbA/S, and HbS/ S genotypes (Table 1). Genotypes were confirmed by the National Haemoglobinopathy Reference Service.

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment