Rt Pcr2 Pcr3 Pcr4

cgcaccgdggatcctaggc (g/ag) cgcaccgaggatcctaggcatt (g/ag) cgcaccggggatcctaggcaat (g/ag) cgcaccggggatcctaggctt (g/ag)

Family Family Family Family

Positive with high-titered serum and CSF

[22]

aHomology of primers to published virus sequences (GenBank); X/Y/Z score: X, number of published sequences overlapping the primer-binding site (the more the better); Y, sequences containing > 5 mismatches (the lesser the better); Z, sequences containing > 2 mismatches within 5 bases from the 3'-end of the primer or a mismatch at the ultimate 3'-base of the primer (the lesser the better). Abbreviations: g/ag, genomic/antigenomic primer; p, probe; SB, Southern blot; FAM, 6-carboxyfluorescein; TX 3,6-carboxytetramethylrodamine.

aHomology of primers to published virus sequences (GenBank); X/Y/Z score: X, number of published sequences overlapping the primer-binding site (the more the better); Y, sequences containing > 5 mismatches (the lesser the better); Z, sequences containing > 2 mismatches within 5 bases from the 3'-end of the primer or a mismatch at the ultimate 3'-base of the primer (the lesser the better). Abbreviations: g/ag, genomic/antigenomic primer; p, probe; SB, Southern blot; FAM, 6-carboxyfluorescein; TX 3,6-carboxytetramethylrodamine.

regions which are now being used to develop a PCR assay that is able to detect various Old World arenaviruses such as Lassa virus and lymphocytic choriomeningitis virus. In conclusion, suspected Lassa virus infections will be identified by PCR with high probability after day 3 of illness, but primers may fail because of the variability of the virus.

Getting Started With Dumbbells

Getting Started With Dumbbells

The use of dumbbells gives you a much more comprehensive strengthening effect because the workout engages your stabilizer muscles, in addition to the muscle you may be pin-pointing. Without all of the belts and artificial stabilizers of a machine, you also engage your core muscles, which are your body's natural stabilizers.

Get My Free Ebook


Post a comment